Login to display prices
Login to display prices
HYI-hydroxypyruvate isomerase homolog (E. coli) Gene View larger

HYI-hydroxypyruvate isomerase homolog (E. coli) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HYI-hydroxypyruvate isomerase homolog (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HYI-hydroxypyruvate isomerase homolog (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019041
Product type: DNA & cDNA
Ncbi symbol: HYI
Origin species: Human
Product name: HYI-hydroxypyruvate isomerase homolog (E. coli) Gene
Size: 2ug
Accessions: BC019041
Gene id: 81888
Gene description: hydroxypyruvate isomerase homolog (E. coli)
Synonyms: HT036; endothelial cell apoptosis protein E-CE1; hydroxypyruvate isomerase homolog; hydroxypyruvate isomerase (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctgggggccgtccccgggagacaggcggccttccgagagggactggagcaggccgtgcggtatgccaaagccctgggctgtcccaggatccacctgatggctggccgagtaccccagggagctgatcgaatagcagtcaaggctgagatggaggccgtttttctggagaacctgaggcatgcagctggggttttggctcaggaggacctcgtgggactgctggagcccatcaacacccgcatcactgatccccagtacttcctggacacgccccagcaggcggcagccatcttacagaaggtaggaagacccaacctccaattacaaatggacatattccactggcagatcatggatgggaacctgacaggaaacatccgggagttcctgcccattgttgggcatgtgcaggtggcacaggtcccaggccgaggggagcccagcagccccggagagctgaatttcccctatctgtttcaactgctggaagatgaaggctacaaaggcttcgtgggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidylprolyl isomerase H (cyclophilin H)
- peptidylprolyl isomerase C (cyclophilin C)
- lysosomal protein transmembrane 4 alpha
- CCR4-NOT transcription complex, subunit 7