Login to display prices
Login to display prices
PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene View larger

PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene

PTXBC002678

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene

Proteogenix catalog: PTXBC002678
Ncbi symbol: PPIC
Product name: PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene
Size: 2ug
Accessions: BC002678
Gene id: 5480
Gene description: peptidylprolyl isomerase C (cyclophilin C)
Synonyms: CYPC; peptidyl-prolyl cis-trans isomerase C; PPIase C; cyclophilin C; parvulin; rotamase C; peptidylprolyl isomerase C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcccgggtcctcggctgctgctacctctcgtgctttgcgtggggctcggcgcacttgtgttttcttcgggggccgagggcttccgcaagcgaggcccctcggtgacggccaaggtcttctttgatgtgaggattggagacaaagatgttggcagaattgtgattggcctctttggaaaagttgtgcccaagacagtggaaaattttgttgctctagcaacaggagagaaaggatatggatataaaggaagcaagtttcatcgtgtcatcaaggatttcatgattcaaggaggtgacatcaccactggagatggcactgggggtgtgagcatctatggtgagacatttccagatgagaacttcaagctgaagcactatggcattgggtgggtcagcatggccaacgctgggcctgacaccaatggctctcagttctttatcaccttgaccaagcccacctggttggacggcaaacatgtggtgtttggaaaagtcattgatgggatgacagtggtgcactccatagagctccaagcaactgatgggcatgaccgtccactcaccaactgctcgatcatcaacagtggcaagatagacgtgaaaacgccttttgtggttgagatcgctgattggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: