Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002678 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPIC |
| Origin species: | Human |
| Product name: | PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene |
| Size: | 2ug |
| Accessions: | BC002678 |
| Gene id: | 5480 |
| Gene description: | peptidylprolyl isomerase C (cyclophilin C) |
| Synonyms: | CYPC; peptidyl-prolyl cis-trans isomerase C; PPIase C; cyclophilin C; parvulin; rotamase C; peptidylprolyl isomerase C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcccgggtcctcggctgctgctacctctcgtgctttgcgtggggctcggcgcacttgtgttttcttcgggggccgagggcttccgcaagcgaggcccctcggtgacggccaaggtcttctttgatgtgaggattggagacaaagatgttggcagaattgtgattggcctctttggaaaagttgtgcccaagacagtggaaaattttgttgctctagcaacaggagagaaaggatatggatataaaggaagcaagtttcatcgtgtcatcaaggatttcatgattcaaggaggtgacatcaccactggagatggcactgggggtgtgagcatctatggtgagacatttccagatgagaacttcaagctgaagcactatggcattgggtgggtcagcatggccaacgctgggcctgacaccaatggctctcagttctttatcaccttgaccaagcccacctggttggacggcaaacatgtggtgtttggaaaagtcattgatgggatgacagtggtgcactccatagagctccaagcaactgatgggcatgaccgtccactcaccaactgctcgatcatcaacagtggcaagatagacgtgaaaacgccttttgtggttgagatcgctgattggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lysosomal protein transmembrane 4 alpha - CCR4-NOT transcription complex, subunit 7 - F-box and leucine-rich repeat protein 18 - membrane-associated ring finger (C3HC4) 8 |