PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene View larger

PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene

PTXBC002678

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002678
Product type: DNA & cDNA
Ncbi symbol: PPIC
Origin species: Human
Product name: PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene
Size: 2ug
Accessions: BC002678
Gene id: 5480
Gene description: peptidylprolyl isomerase C (cyclophilin C)
Synonyms: CYPC; peptidyl-prolyl cis-trans isomerase C; PPIase C; cyclophilin C; parvulin; rotamase C; peptidylprolyl isomerase C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcccgggtcctcggctgctgctacctctcgtgctttgcgtggggctcggcgcacttgtgttttcttcgggggccgagggcttccgcaagcgaggcccctcggtgacggccaaggtcttctttgatgtgaggattggagacaaagatgttggcagaattgtgattggcctctttggaaaagttgtgcccaagacagtggaaaattttgttgctctagcaacaggagagaaaggatatggatataaaggaagcaagtttcatcgtgtcatcaaggatttcatgattcaaggaggtgacatcaccactggagatggcactgggggtgtgagcatctatggtgagacatttccagatgagaacttcaagctgaagcactatggcattgggtgggtcagcatggccaacgctgggcctgacaccaatggctctcagttctttatcaccttgaccaagcccacctggttggacggcaaacatgtggtgtttggaaaagtcattgatgggatgacagtggtgcactccatagagctccaagcaactgatgggcatgaccgtccactcaccaactgctcgatcatcaacagtggcaagatagacgtgaaaacgccttttgtggttgagatcgctgattggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lysosomal protein transmembrane 4 alpha
- CCR4-NOT transcription complex, subunit 7
- F-box and leucine-rich repeat protein 18
- membrane-associated ring finger (C3HC4) 8

Buy PPIC-peptidylprolyl isomerase C (cyclophilin C) Gene now

Add to cart