Cart 9 Product Products 1 278,02 € (empty)
-
1 x DEFB1-defe...113,40 € -
-
1 x Goat...199,00 € -
1 x PPAP2B-pho...121,50 € -
1 x HSDL1-hydr...121,50 € -
1 x ACTR2-ARP2...121,50 € -
1 x PRPF40A-PR...113,40 € -
1 x GMPR2-guan...121,50 € -
1 x Chicken...311,00 €
No products
To be determined Shipping
1 278,02 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 278,02 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 278,02 €
View larger 
Data sheet of 39515-membrane-associated ring finger (C3HC4) 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about 39515-membrane-associated ring finger (C3HC4) 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025394 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | 39515 |
| Origin species: | Human |
| Product name: | 39515-membrane-associated ring finger (C3HC4) 8 Gene |
| Size: | 2ug |
| Accessions: | BC025394 |
| Gene id: | 220972 |
| Gene description: | membrane-associated ring finger (C3HC4) 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcatgccactgcatcagatctctgccattccatcccaggatgccatctctgctagagtctacagaagtaagaccaaagaaaaggagagggaagaacagaatgagaagactttgggacatttcatgagtcattcaagcaacatttctaaggctgggagtcctccgtcagcatcagctccggctccggtgtcctccttctctcgcacttctatcacgccatccagccaggacatctgcaggatctgccactgtgaaggagatgatgagagccccctgatcaccccctgccactgcacaggaagcctccacttcgtgcaccaggcctgcctgcagcagtggatcaagagctccgacacgcgctgctgcgagctctgcaagtatgagttcatcatggagaccaagctgaagccactgagaaaatgggagaagttgcagatgacgtccagcgagcgcaggaagatcatgtgctcagtgacattccacgtcattgccatcacatgtgtggtctggtccttgtatgtgctcattgaccgtactgctgaggagatcaagcaggggcaggcaacaggaatcctagaatggcccttttggactaaattggtggttgtggccatcggcttcaccggaggacttctttttatgtatgttcagtgtaaagtgtatgtgcaattgtggaagagactcaaggcctataatagagtgatctatgttcaaaactgtccagaaacaagcaaaaagaatatttttgaaaaatctccactaacagagcccaactttgaaaataaacatggacatggaatctgtcattccgacacaaactcttcttgttgcacagagcctgaagacactggagcagaaatcattcacgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CCR4-NOT transcription complex, subunit 8 - cell division cycle 2, G1 to S and G2 to M - nitric oxide synthase interacting protein - peptidylprolyl isomerase E (cyclophilin E) |