39515-membrane-associated ring finger (C3HC4) 8 Gene View larger

39515-membrane-associated ring finger (C3HC4) 8 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of 39515-membrane-associated ring finger (C3HC4) 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about 39515-membrane-associated ring finger (C3HC4) 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025394
Product type: DNA & cDNA
Ncbi symbol: 39515
Origin species: Human
Product name: 39515-membrane-associated ring finger (C3HC4) 8 Gene
Size: 2ug
Accessions: BC025394
Gene id: 220972
Gene description: membrane-associated ring finger (C3HC4) 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcatgccactgcatcagatctctgccattccatcccaggatgccatctctgctagagtctacagaagtaagaccaaagaaaaggagagggaagaacagaatgagaagactttgggacatttcatgagtcattcaagcaacatttctaaggctgggagtcctccgtcagcatcagctccggctccggtgtcctccttctctcgcacttctatcacgccatccagccaggacatctgcaggatctgccactgtgaaggagatgatgagagccccctgatcaccccctgccactgcacaggaagcctccacttcgtgcaccaggcctgcctgcagcagtggatcaagagctccgacacgcgctgctgcgagctctgcaagtatgagttcatcatggagaccaagctgaagccactgagaaaatgggagaagttgcagatgacgtccagcgagcgcaggaagatcatgtgctcagtgacattccacgtcattgccatcacatgtgtggtctggtccttgtatgtgctcattgaccgtactgctgaggagatcaagcaggggcaggcaacaggaatcctagaatggcccttttggactaaattggtggttgtggccatcggcttcaccggaggacttctttttatgtatgttcagtgtaaagtgtatgtgcaattgtggaagagactcaaggcctataatagagtgatctatgttcaaaactgtccagaaacaagcaaaaagaatatttttgaaaaatctccactaacagagcccaactttgaaaataaacatggacatggaatctgtcattccgacacaaactcttcttgttgcacagagcctgaagacactggagcagaaatcattcacgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CCR4-NOT transcription complex, subunit 8
- cell division cycle 2, G1 to S and G2 to M
- nitric oxide synthase interacting protein
- peptidylprolyl isomerase E (cyclophilin E)

Buy 39515-membrane-associated ring finger (C3HC4) 8 Gene now

Add to cart