PPIE-peptidylprolyl isomerase E (cyclophilin E) Gene View larger

PPIE-peptidylprolyl isomerase E (cyclophilin E) Gene

PTXBC004898

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPIE-peptidylprolyl isomerase E (cyclophilin E) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPIE-peptidylprolyl isomerase E (cyclophilin E) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004898
Product type: DNA & cDNA
Ncbi symbol: PPIE
Origin species: Human
Product name: PPIE-peptidylprolyl isomerase E (cyclophilin E) Gene
Size: 2ug
Accessions: BC004898
Gene id: 10450
Gene description: peptidylprolyl isomerase E (cyclophilin E)
Synonyms: CYP-33; CYP33; peptidyl-prolyl cis-trans isomerase E; PPIase E; cyclophilin-33; peptidylprolyl isomerase E (cyclophilin E); rotamase E; peptidylprolyl isomerase E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaccaccaagcgcgtcttgtacgtgggtggactggcagaggaagtggacgacaaagttcttcatgctgcgttcattccttttggagacatcacagatattcagattcctctggattatgaaacagaaaagcaccgaggatttgcttttgttgaatttgagttggcagaggatgctgcagcagctatcgacaacatgaatgaatctgagctttttggacgtacaattcgtgtcaatttggccaaaccaatgagaattaaggaaggctcttccaggccagtttggtcagatgatgactggttgaagaagttttctgggaagacgcttgaagagaataaagaggaagaagggtcagagcctcccaaagcagagacccaggagggagagcccattgctaaaaaggcccgctcaaatcctcaggtgtacatggacatcaagattgggaacaagccggctggccgcatccagatgctcctgcgttctgatgtcgtgcccatgacagcagagaatttccgctgcctgtgcactcatgaaaagggctttggctttaagggaagcagcttccaccgcatcatcccccagttcatgtgccagggcggtgatttcacaaaccacaatggcactgggggcaagtccatctatgggaagaagttcgatgatgaaaactttatcctcaagcatacgggaccaggtctactatccatggccaactctggcccaaacaccaatggctctcagttcttcctgacatgtgacaagacagactggctggatggcaagcatgtggtgtttggagaggtcaccgaaggcctagatgtcttgcggcaaattgaggcccagggcagcaaggacgggaagccaaagcagaaggtgatcatcgccgactgtggggagtacgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger and BTB domain containing 32
- Vps20-associated 1 homolog (S. cerevisiae)
- phosphoribosyl pyrophosphate synthetase 1
- myeloid-associated differentiation marker

Buy PPIE-peptidylprolyl isomerase E (cyclophilin E) Gene now

Add to cart