VTA1-Vps20-associated 1 homolog (S. cerevisiae) Gene View larger

VTA1-Vps20-associated 1 homolog (S. cerevisiae) Gene

PTXBC005937

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VTA1-Vps20-associated 1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VTA1-Vps20-associated 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005937
Product type: DNA & cDNA
Ncbi symbol: VTA1
Origin species: Human
Product name: VTA1-Vps20-associated 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC005937
Gene id: 51534
Gene description: Vps20-associated 1 homolog (S. cerevisiae)
Synonyms: vacuolar protein sorting-associated protein VTA1 homolog; C6orf55; DRG-1; DRG1; HSPC228; LIP5; My012; SBP1; LYST-interacting protein 5; SKD1-binding protein 1; Vps20-associated 1 homolog; dopamine-responsive gene 1 protein; homolog of mouse SKD1-binding protein 1; vesicle (multivesicular body) trafficking 1; vesicle trafficking 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcgcttgcaccgctgcccccgctccccgcacagttcaagagcatacagcatcatctgaggacggctcaggagcatgacaagcgagaccctgtggtggcttattactgtcgtttatacgcaatgcagactggaatgaagatcgatagtaaaactcctgaatgtcgcaaatttttatcaaagttaatggatcagttagaagctctaaagaagcagttgggtgataatgaagctattactcaagaaatagtgggctgtgcccatttggagaattatgctttgaaaatgtttttgtatgcagacaatgaagatcgtgctggacgatttcacaaaaacatgatcaagtccttctatactgcaagtcttttgatagatgtcataacagtatttggagaactcactgatgaaaatgtgaaacacaggaagtatgccagatggaaggcaacatacatccataattgtttaaagaatggggagactcctcaagcaggccctgttggaattgaagaagataatgatattgaagaaaatgaagatgctggagcagcctctctgcccactcagccaactcagccatcatcatcttcaacttatgacccaagcaacatgccatcaggcaactatactggaatacagattcctccgggtgcacacgctccagctaatacaccagcagaagtgcctcacagcacaggtgtagcaagtaatactatccaacctactccacagactatacctgccattgatcccgcacttttcaatacaatttcccagggggatgttcgtctaaccccagaagactttgctagagctcagaagtactgcaaatatgctggcagtgctttgcagtatgaagatgtaagcactgctgtccagaatctacaaaaggctctcaagttactgacgacaggcagagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphoribosyl pyrophosphate synthetase 1
- myeloid-associated differentiation marker
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
- F-box and leucine-rich repeat protein 12

Buy VTA1-Vps20-associated 1 homolog (S. cerevisiae) Gene now

Add to cart