Login to display prices
Login to display prices
ZBTB32-zinc finger and BTB domain containing 32 Gene View larger

ZBTB32-zinc finger and BTB domain containing 32 Gene

PTXBC017700

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZBTB32-zinc finger and BTB domain containing 32 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZBTB32-zinc finger and BTB domain containing 32 Gene

Proteogenix catalog: PTXBC017700
Ncbi symbol: ZBTB32
Product name: ZBTB32-zinc finger and BTB domain containing 32 Gene
Size: 2ug
Accessions: BC017700
Gene id: 27033
Gene description: zinc finger and BTB domain containing 32
Synonyms: FAXF; FAZF; Rog; TZFP; ZNF538; zinc finger and BTB domain-containing protein 32; FANCC-interacting protein; fanconi anemia zinc finger protein; repressor of GATA; testis zinc finger protein; zinc finger protein 538; zinc finger and BTB domain containing 32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccctgccccccataagactgcccagcccctatggctctgatcggctggtacagctagcagccaggctccggccagcactctgtgatactctgatcaccgtagggagccaggagttccccgcccacagcctggtgctagcaggtgtcagccagcagctgggccgcaggggccagtgggctctgggagaaggcatcagcccttctacctttgcccagctcctgaactttgtgtatggggagagtgtagagctgcagcctggagagctaaggccccttcaggaggcggccagggccttgggagtgcagtccctggaagaggcatgctggagggctcgaggggacagggctaaaaagccagatccaggcctgaagaaacatcaggaggagccagagaaaccctcaaggaatcctgagagagaactgggggaccctggagagaagcagaaaccagaacaggtttctagaactggtgggagagaacaggagatgttgcacaagcactcgccaccaagaggcagacccgagatggcaggagcaacgcaggaggctcagcaggaacagaccaggtcaaaggagaaacgcctccaagcccctgttggccaaaggggagcagatgggaagcatggagtgctcacgtggttgagggaaaatccagggggctctgaggaaagtctgcgcaagctccctggcccccttcccccagcaggctccctgcaaaccagcgtcacccctaggccctcgtgggctgaggccccttggttggtggggggccagcctgccctgtggagcatcctgctgatgccgcccagatatggcattcccttctaccatagcacccccaccactggagcctggcaggaggtctggcgggaacagaggcgcacttgcaacctgtgcgggtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: