Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ZBTB32-zinc finger and BTB domain containing 32 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZBTB32-zinc finger and BTB domain containing 32 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017700 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZBTB32 |
| Origin species: | Human |
| Product name: | ZBTB32-zinc finger and BTB domain containing 32 Gene |
| Size: | 2ug |
| Accessions: | BC017700 |
| Gene id: | 27033 |
| Gene description: | zinc finger and BTB domain containing 32 |
| Synonyms: | FAXF; FAZF; Rog; TZFP; ZNF538; zinc finger and BTB domain-containing protein 32; FANCC-interacting protein; fanconi anemia zinc finger protein; repressor of GATA; testis zinc finger protein; zinc finger protein 538; zinc finger and BTB domain containing 32 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccctgccccccataagactgcccagcccctatggctctgatcggctggtacagctagcagccaggctccggccagcactctgtgatactctgatcaccgtagggagccaggagttccccgcccacagcctggtgctagcaggtgtcagccagcagctgggccgcaggggccagtgggctctgggagaaggcatcagcccttctacctttgcccagctcctgaactttgtgtatggggagagtgtagagctgcagcctggagagctaaggccccttcaggaggcggccagggccttgggagtgcagtccctggaagaggcatgctggagggctcgaggggacagggctaaaaagccagatccaggcctgaagaaacatcaggaggagccagagaaaccctcaaggaatcctgagagagaactgggggaccctggagagaagcagaaaccagaacaggtttctagaactggtgggagagaacaggagatgttgcacaagcactcgccaccaagaggcagacccgagatggcaggagcaacgcaggaggctcagcaggaacagaccaggtcaaaggagaaacgcctccaagcccctgttggccaaaggggagcagatgggaagcatggagtgctcacgtggttgagggaaaatccagggggctctgaggaaagtctgcgcaagctccctggcccccttcccccagcaggctccctgcaaaccagcgtcacccctaggccctcgtgggctgaggccccttggttggtggggggccagcctgccctgtggagcatcctgctgatgccgcccagatatggcattcccttctaccatagcacccccaccactggagcctggcaggaggtctggcgggaacagaggcgcacttgcaacctgtgcgggtcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Vps20-associated 1 homolog (S. cerevisiae) - phosphoribosyl pyrophosphate synthetase 1 - myeloid-associated differentiation marker - DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 |