ZBTB32-zinc finger and BTB domain containing 32 Gene View larger

ZBTB32-zinc finger and BTB domain containing 32 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZBTB32-zinc finger and BTB domain containing 32 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZBTB32-zinc finger and BTB domain containing 32 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017700
Product type: DNA & cDNA
Ncbi symbol: ZBTB32
Origin species: Human
Product name: ZBTB32-zinc finger and BTB domain containing 32 Gene
Size: 2ug
Accessions: BC017700
Gene id: 27033
Gene description: zinc finger and BTB domain containing 32
Synonyms: FAXF; FAZF; Rog; TZFP; ZNF538; zinc finger and BTB domain-containing protein 32; FANCC-interacting protein; fanconi anemia zinc finger protein; repressor of GATA; testis zinc finger protein; zinc finger protein 538; zinc finger and BTB domain containing 32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccctgccccccataagactgcccagcccctatggctctgatcggctggtacagctagcagccaggctccggccagcactctgtgatactctgatcaccgtagggagccaggagttccccgcccacagcctggtgctagcaggtgtcagccagcagctgggccgcaggggccagtgggctctgggagaaggcatcagcccttctacctttgcccagctcctgaactttgtgtatggggagagtgtagagctgcagcctggagagctaaggccccttcaggaggcggccagggccttgggagtgcagtccctggaagaggcatgctggagggctcgaggggacagggctaaaaagccagatccaggcctgaagaaacatcaggaggagccagagaaaccctcaaggaatcctgagagagaactgggggaccctggagagaagcagaaaccagaacaggtttctagaactggtgggagagaacaggagatgttgcacaagcactcgccaccaagaggcagacccgagatggcaggagcaacgcaggaggctcagcaggaacagaccaggtcaaaggagaaacgcctccaagcccctgttggccaaaggggagcagatgggaagcatggagtgctcacgtggttgagggaaaatccagggggctctgaggaaagtctgcgcaagctccctggcccccttcccccagcaggctccctgcaaaccagcgtcacccctaggccctcgtgggctgaggccccttggttggtggggggccagcctgccctgtggagcatcctgctgatgccgcccagatatggcattcccttctaccatagcacccccaccactggagcctggcaggaggtctggcgggaacagaggcgcacttgcaacctgtgcgggtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Vps20-associated 1 homolog (S. cerevisiae)
- phosphoribosyl pyrophosphate synthetase 1
- myeloid-associated differentiation marker
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 47

Buy ZBTB32-zinc finger and BTB domain containing 32 Gene now

Add to cart