Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CDC2-cell division cycle 2, G1 to S and G2 to M Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDC2-cell division cycle 2, G1 to S and G2 to M Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014563 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDC2 |
| Origin species: | Human |
| Product name: | CDC2-cell division cycle 2, G1 to S and G2 to M Gene |
| Size: | 2ug |
| Accessions: | BC014563 |
| Gene id: | 983 |
| Gene description: | cell division cycle 2, G1 to S and G2 to M |
| Synonyms: | cell cycle controller CDC2; CDC28A; P34CDC2; cyclin-dependent kinase 1; cell division control protein 2 homolog; cell division cycle 2, G1 to S and G2 to M; cell division protein kinase 1; p34 protein kinase; cyclin dependent kinase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagattataccaaaatagagaaaattggagaaggtacctatggagttgtgtataagggtagacacaaaactacaggtcaagtggtagccatgaaaaaaatcagactagaaagtgaagaggaaggggttcctagtactgcaattcgggaaatttctctattaaaggaacttcgtcatccaaatatagtcagtcttcaggatgtgcttatgcaggattccaggttatatctcatctttgagtttctttccatggatctgaagaaatacttggattctatccctcctggtcagtacatggattcttcacttgttaagagttatttataccaaatcctacaggggattgtgttttgtcactctagaagagttcttcacagagacttaaaacctcaaaatctcttgattgatgacaaaggaacaattaaactggctgattttggccttgccagagcttttggaatacctatcagagtatatacacatgaggtagtaacactctggtacagatctccagaagtattgctggggtcagctcgttactcaactccagttgacatttggagtataggcaccatatttgctgaactagcaactaagaaaccacttttccatggggattcagaaattgatcaactcttcaggattttcagagctttgggcactcccaataatgaagtgtggccagaagtggaatctttacaggactataagaatacatttcccaaatggaaaccaggaagcctagcatcccatgtcaaaaacttggatgaaaatggcttggatttgctctcgaaaatgttaatctatgatccagccaaacgaatttctggcaaaatggcactgaatcatccatattttaatgatttggacaatcagattaagaagatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nitric oxide synthase interacting protein - peptidylprolyl isomerase E (cyclophilin E) - zinc finger and BTB domain containing 32 - Vps20-associated 1 homolog (S. cerevisiae) |