Login to display prices
Login to display prices
CNOT7-CCR4-NOT transcription complex, subunit 7 Gene View larger

CNOT7-CCR4-NOT transcription complex, subunit 7 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNOT7-CCR4-NOT transcription complex, subunit 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CNOT7-CCR4-NOT transcription complex, subunit 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007315
Product type: DNA & cDNA
Ncbi symbol: CNOT7
Origin species: Human
Product name: CNOT7-CCR4-NOT transcription complex, subunit 7 Gene
Size: 2ug
Accessions: BC007315
Gene id: 29883
Gene description: CCR4-NOT transcription complex, subunit 7
Synonyms: CAF-1; CAF1; Caf1a; hCAF-1; CCR4-NOT transcription complex subunit 7; BTG1-binding factor 1; CCR4-associated factor 1; carbon catabolite repressor protein (CCR4)-associative factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagcggcaactgtagatcatagccaaagaatttgtgaagtttgggcttgcaacttggatgaagagatgaagaaaattcgtcaagttatccgaaaatataattacgttgctatggacaccgagtttccaggtgtggttgcaagacccattggagaattcaggagcaatgctgactatcaataccaactattgcggtgtaatgtagacttgttaaagataattcagctaggactgacatttatgaatgagcaaggagaataccctccaggaacttcaacttggcagtttaattttaaatttaatttgacggaggacatgtatgcccaggactctatagagctactaacaacatctggtatccagtttaaaaaacatgaggaggaaggaattgaaacccagtactttgcagaacttcttatgatttctggagtggtcctctgtgaaggggtcaaatggttgtcatttcatagcggttacgactttggctacttaatcaaaatcctaaccaactctaacttgcctgaagaagaacttgacttctttgagatccttcgattgttttttcctgtcatttatgatgtgaagtacctcatgaagagctgcaaaaatctcaaaggtggattacaggaggtggcagaacagttagagctggaacggataggaccacaacatcaggcaggatctgattcattgctcacagggaatgcatatgaagaggaagccaacaagcagtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box and leucine-rich repeat protein 18
- membrane-associated ring finger (C3HC4) 8
- CCR4-NOT transcription complex, subunit 8
- cell division cycle 2, G1 to S and G2 to M