Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CNOT7-CCR4-NOT transcription complex, subunit 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CNOT7-CCR4-NOT transcription complex, subunit 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007315 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CNOT7 |
| Origin species: | Human |
| Product name: | CNOT7-CCR4-NOT transcription complex, subunit 7 Gene |
| Size: | 2ug |
| Accessions: | BC007315 |
| Gene id: | 29883 |
| Gene description: | CCR4-NOT transcription complex, subunit 7 |
| Synonyms: | CAF-1; CAF1; Caf1a; hCAF-1; CCR4-NOT transcription complex subunit 7; BTG1-binding factor 1; CCR4-associated factor 1; carbon catabolite repressor protein (CCR4)-associative factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagcggcaactgtagatcatagccaaagaatttgtgaagtttgggcttgcaacttggatgaagagatgaagaaaattcgtcaagttatccgaaaatataattacgttgctatggacaccgagtttccaggtgtggttgcaagacccattggagaattcaggagcaatgctgactatcaataccaactattgcggtgtaatgtagacttgttaaagataattcagctaggactgacatttatgaatgagcaaggagaataccctccaggaacttcaacttggcagtttaattttaaatttaatttgacggaggacatgtatgcccaggactctatagagctactaacaacatctggtatccagtttaaaaaacatgaggaggaaggaattgaaacccagtactttgcagaacttcttatgatttctggagtggtcctctgtgaaggggtcaaatggttgtcatttcatagcggttacgactttggctacttaatcaaaatcctaaccaactctaacttgcctgaagaagaacttgacttctttgagatccttcgattgttttttcctgtcatttatgatgtgaagtacctcatgaagagctgcaaaaatctcaaaggtggattacaggaggtggcagaacagttagagctggaacggataggaccacaacatcaggcaggatctgattcattgctcacagggaatgcatatgaagaggaagccaacaagcagtcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box and leucine-rich repeat protein 18 - membrane-associated ring finger (C3HC4) 8 - CCR4-NOT transcription complex, subunit 8 - cell division cycle 2, G1 to S and G2 to M |