Login to display prices
Login to display prices
PPIH-peptidylprolyl isomerase H (cyclophilin H) Gene View larger

PPIH-peptidylprolyl isomerase H (cyclophilin H) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPIH-peptidylprolyl isomerase H (cyclophilin H) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPIH-peptidylprolyl isomerase H (cyclophilin H) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003412
Product type: DNA & cDNA
Ncbi symbol: PPIH
Origin species: Human
Product name: PPIH-peptidylprolyl isomerase H (cyclophilin H) Gene
Size: 2ug
Accessions: BC003412
Gene id: 10465
Gene description: peptidylprolyl isomerase H (cyclophilin H)
Synonyms: CYP-20; CYPH; SnuCyp-20; USA-CYP; peptidyl-prolyl cis-trans isomerase H; PPIase h; U-snRNP-associated cyclophilin SnuCyp-20; U-snRNP-associated cyclophilin SunCyp-20; USA-CyP SnuCyp-20; cyclophilin H; rotamase H; small nuclear ribonucleoprotein particle-specific cyclophilin H; peptidylprolyl isomerase H
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtggcaaattcaagtcctgttaaccccgtggtgttctttgatgtcagtattggcggtcaggaagttggccgcatgaagatcgagctctttgcagacgttgtgcctaagacggccgagaactttaggcagttctgcaccggagaattcaggaaagatggggttccaataggatacaaaggaagcaccttccacagggtcataaaggatttcatgattcagggtggagattttgttaatggagatggtactggagtcgccagtatttaccgggggccatttgcagatgaaaattttaaacttagacactcagctccaggcctgctttccatggcgaacagtggtccaagtacaaatggctgtcagttctttatcacctgctctaagtgcgattggctggatgggaagcatgtggtgtttggaaaaatcatcgatggacttctagtgatgagaaagattgagaatgttcccacaggccccaacaataagcccaagctacctgtggtgatctcgcagtgtggggagatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidylprolyl isomerase C (cyclophilin C)
- lysosomal protein transmembrane 4 alpha
- CCR4-NOT transcription complex, subunit 7
- F-box and leucine-rich repeat protein 18