Login to display prices
Login to display prices
CFL1-cofilin 1 (non-muscle) Gene View larger

CFL1-cofilin 1 (non-muscle) Gene

PTXBC011005

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CFL1-cofilin 1 (non-muscle) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CFL1-cofilin 1 (non-muscle) Gene

Proteogenix catalog: PTXBC011005
Ncbi symbol: CFL1
Product name: CFL1-cofilin 1 (non-muscle) Gene
Size: 2ug
Accessions: BC011005
Gene id: 1072
Gene description: cofilin 1 (non-muscle)
Synonyms: CFL; HEL-S-15; cofilin; cofilin-1; 18 kDa phosphoprotein; cofilin 1 (non-muscle); cofilin, non-muscle isoform; epididymis secretory protein Li 15; p18; cofilin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctccggtgtggctgtctctgatggtgtcatcaaggtgttcaacgacatgaaggtgcgtaagtcttcaacgccagaggaggtgaagaagcgcaagaaggcggtgctcttctgcctgagtgaggacaagaagaacatcatcctggaggagggcaaggagatcctggtgggcgatgtgggccagactgtcgacgatccctacgccacctttgtcaagatgctgccagataaggactgccgctatgccctctatgatgcaacctatgagaccaaggagagcaagaaggaggatctggtgtttatcttctgggcccccgagtctgcgccccttaagagcaaaatgatttatgccagctccaaggacgccatcaagaagaagctgacagggatcaagcatgaattgcaagcaaactgctacgaggaggtcaaggaccgctgcaccctggcagagaagctggggggcagtgccgtcatctccctggagggcaagcctttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice