Login to display prices
Login to display prices
ETNK1-ethanolamine kinase 1 Gene View larger

ETNK1-ethanolamine kinase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ETNK1-ethanolamine kinase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ETNK1-ethanolamine kinase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006111
Product type: DNA & cDNA
Ncbi symbol: ETNK1
Origin species: Human
Product name: ETNK1-ethanolamine kinase 1 Gene
Size: 2ug
Accessions: BC006111
Gene id: 55500
Gene description: ethanolamine kinase 1
Synonyms: EKI; EKI 1; Nbla10396; ethanolamine kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaattacatccacgtccctcccggctccccggaggtgcccaagctgaacgtcaccgttcaggatcaggaggagcatcgctgccgggagggggccctgagcctcctgcaacacctgcggcctcactgggacccccaggaggtgaccctgcagctcttcacagatggaatcacaaataaacttattggctgttacgtgggaaacaccatggaggatgtagtcctggtgagaatttatggcaataagactgagttattagtcgatcgagatgaggaagtaaagagttttcgagtgttgcaggctcatgggtgtgcaccacaactctactgtaccttcaataatggactatgctatgaatttatacaaggagaagcactggatccaaagcatgtctgcaacccagccattttcagtttatcatcgttgactctttgcaaaggaaaaactacaagatgttttggattaaccggctgcagagggtcaaggcttctgcttagttttttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L18
- ribosomal protein L14
- ribosomal protein L14
- ribosomal protein L14