Login to display prices
Login to display prices
RPL14-ribosomal protein L14 Gene View larger

RPL14-ribosomal protein L14 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL14-ribosomal protein L14 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL14-ribosomal protein L14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005134
Product type: DNA & cDNA
Ncbi symbol: RPL14
Origin species: Human
Product name: RPL14-ribosomal protein L14 Gene
Size: 2ug
Accessions: BC005134
Gene id: 9045
Gene description: ribosomal protein L14
Synonyms: CAG-ISL-7; CTG-B33; L14; RL14; hRL14; 60S ribosomal protein L14; ribosomal protein L14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgttcaggcgcttcgtggaggttggccgggtggcctatgtctcctttggacctcatgccggaaaattggtcgcgattgtagatgttattgatcagaacagggctttggtcgatggaccttgcactcaagtgaggagacaggccatgcctttcaagtgcatgcagctcactgatttcatcctcaagtttccgcacagtgcccaccagaagtatgtccgacaagcctggcagaaggcagacatcaatacaaaatgggcagccacacgatgggccaagaagattgaagccagagaaaggaaagccaagatgacagattttgatcgttttaaagttatgaaggcaaagaaaatgaggaacagaataatcaagaatgaagttaagaagcttcaaaaggcagctctcctgaaatcttctcccaaaaaagcacctggtactaagggtactgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctaaagttccagcaaaaaagatcaccgccgcgagtaaaaaggctccagcccagaaggttcctgcccagaaagccacaggccagaaagcagcgcctgctccaaaagctcagaagggtcaaaaagctccagcccagaaagcacctgctccaaaggcatctggcaagaaagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - distal-less homeobox 1
- distal-less homeobox 4
- ribosomal protein S3A
- RASD family, member 2