Login to display prices
Login to display prices
RPL18-ribosomal protein L18 Gene View larger

RPL18-ribosomal protein L18 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL18-ribosomal protein L18 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL18-ribosomal protein L18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000374
Product type: DNA & cDNA
Ncbi symbol: RPL18
Origin species: Human
Product name: RPL18-ribosomal protein L18 Gene
Size: 2ug
Accessions: BC000374
Gene id: 6141
Gene description: ribosomal protein L18
Synonyms: L18; 60S ribosomal protein L18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagtggacatccgccataacaaggaccgaaaggttcggcgcaaggagcccaagagccaggatatctacctgaggctgttggtcaagttatacaggtttctggccagaagaaccaactccacattcaaccaggttgtgttgaagaggttgtttatgagtcgcaccaaccggccgcctctgtccctttcccggatgatccggaagatgaagcttcctggccgggaaaacaagacggccgtggttgtggggaccataactgatgatgtgcgggttcaggaggtacccaaactgaaggtatgtgcactgcgcgtgaccagccgggcccgcagccgcatcctcagggcagggggcaagatcctcactttcgaccagctggccctggactcccctaagggctgtggcactgtcctgctctccggtcctcgcaagggccgagaggtgtaccggcatttcggcaaggccccaggaaccccgcacagccacaccaaaccctacgtccgctccaagggccggaagttcgagcgtgccagaggccgacgggccagccgaggctacaaaaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L14
- ribosomal protein L14
- ribosomal protein L14
- distal-less homeobox 1