Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TCAP-titin-cap (telethonin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TCAP-titin-cap (telethonin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012628 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TCAP |
| Origin species: | Human |
| Product name: | TCAP-titin-cap (telethonin) Gene |
| Size: | 2ug |
| Accessions: | BC012628 |
| Gene id: | 8557 |
| Gene description: | titin-cap (telethonin) |
| Synonyms: | CMD1N; CMH25; LGMD2G; T-cap; TELE; 19 kDa sarcomeric protein; limb girdle muscular dystrophy 2G (autosomal recessive); teneurin C-terminal associated peptide; titin cap protein; titin-cap |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctacctcagagctgagctgcgaggtgtcggaggagaactgtgagcgccgggaggccttctgggcagaatggaaggatctgacactgtccacacggcccgaggagggctgctccctgcatgaggaggacacccagagacatgagacctaccaccagcaggggcagtgccaggtgctggtgcagcgctcgccctggctgatgatgcggatgggcatcctcggccgtgggctgcaggagtaccagctgccctaccagcgggtactgccgctgcccatcttcacccctgccaagatgggcgccaccaaggaggagcgtgaggacacccccatccagcttcaggagctgctggcgctggagacagccctgggtggccagtgtgtggaccgccaggaggtggctgagatcacaaagcagctgccccctgtggtgcctgtcagcaagcccggtgcccttcgtcgctccctgtcccgctccatgtcccaggaagcacagagaggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ethanolamine kinase 1 - ribosomal protein L18 - ribosomal protein L14 - ribosomal protein L14 |