PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene View larger

PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007104
Product type: DNA & cDNA
Ncbi symbol: PPIA
Origin species: Human
Product name: PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene
Size: 2ug
Accessions: BC007104
Gene id: 5478
Gene description: peptidylprolyl isomerase A (cyclophilin A)
Synonyms: CYPH; HEL-S-69p; peptidyl-prolyl cis-trans isomerase A; PPIase A; T cell cyclophilin; cyclosporin A-binding protein; epididymis secretory sperm binding protein Li 69p; peptidylprolyl isomerase A (cyclophilin A); rotamase A; peptidylprolyl isomerase A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcaaccccaccgtgttcttcgacattgccgtcgacggcgagcccttgggccgcgtctcctttgagctgtttgcagacaaggtcccaaagacagcagaaaattttcgtgctctgagcactggagagaaaggatttggttataagggttcctgctttcacagaattattccagggtttatgtgtcagggtggtgacttcacacgccataatggcactggtggcaagtccatctatggggagaaatttgaagatgagaacttcatcctaaagcatacgggtcctggcatcttgtccatggcaaatgctggacccatcacaaatggttcccagtttttcatctgcactgccaagactgagtggttggatggcaagcatgtggtgtttggcaaagtgaaagaaggcatgaatattgtggaggccatggagcgctttgggtccaggaatggcaagaccagcaagaagatcaccattgctgactgtggacaactcgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxypyruvate isomerase homolog (E. coli)
- peptidylprolyl isomerase H (cyclophilin H)
- peptidylprolyl isomerase C (cyclophilin C)
- lysosomal protein transmembrane 4 alpha

Buy PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene now

Add to cart