Login to display prices
Login to display prices
RANGRF-RAN guanine nucleotide release factor Gene View larger

RANGRF-RAN guanine nucleotide release factor Gene

PTXBC006486

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RANGRF-RAN guanine nucleotide release factor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RANGRF-RAN guanine nucleotide release factor Gene

Proteogenix catalog: PTXBC006486
Ncbi symbol: RANGRF
Product name: RANGRF-RAN guanine nucleotide release factor Gene
Size: 2ug
Accessions: BC006486
Gene id: 29098
Gene description: RAN guanine nucleotide release factor
Synonyms: HSPC165; HSPC236; MOG1; RANGNRF; ran guanine nucleotide release factor; MOG1 homolog; ran-binding protein MOG1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcccacgagagactgcccgctgttcgggggcgccttttccgccatcctccccatgggggccattgacgtaagcgacctccgaccggtcccggacaatcaagaagttttctgccatcccgtgacggaccagagcctgatagtggaacttctcgagctgcaggcccacgtacggggcgaagcggctgcgcggtaccactttgaggatgttggtggcgtgcagggggctagggctgtccatgtggagtctgttcagcctctcagtttggagaacctggccctgaggggccgctgtcaagaagcctgggtcctctctggcaagcagcagatagctaaggaaaaccagcaggtgagggcccgagagtgtgtaatgtcctggaagggcggtagcggggacgcagagatccaggtaagcatcctgactctgatccccttaggtagcaaaggacgtgacacttcatcaggccttgctgaggctgccccagtaccagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice