Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RANGRF-RAN guanine nucleotide release factor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RANGRF-RAN guanine nucleotide release factor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012552 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RANGRF |
| Origin species: | Human |
| Product name: | RANGRF-RAN guanine nucleotide release factor Gene |
| Size: | 2ug |
| Accessions: | BC012552 |
| Gene id: | 29098 |
| Gene description: | RAN guanine nucleotide release factor |
| Synonyms: | HSPC165; HSPC236; MOG1; RANGNRF; ran guanine nucleotide release factor; MOG1 homolog; ran-binding protein MOG1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcccacgagagactgcccgctgttcgggggcgccttttccgccatcctccccatgggggccattgacgtaagcgacctccgaccggtcccggacaatcaagaagttttctgccatcccgtgacggaccagagcctgatagtggaacttctcgagctgcaggcccacgtacggggcgaagcggctgcgcggtaccactttgaggatgttggtggcgtgcagggggctagggctgtccatgtggagtctgttcagcctctcagtttggagaacctggccctgaggggccgctgtcaagaagcctgggtcctctctggcaagcagcagatagctaaggaaaaccagcaggtgagggcccgagagtgtgtaatgtcttggaagggcggtagcggggacgcagagatccaggtaagcatcctgactctgatccccttaggtagcaaaggacgtgacacttcatcaggccttgctgaggctgccccagtaccagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAN guanine nucleotide release factor - chromosome 18 open reading frame 10 - chromosome 19 open reading frame 10 - chromosome 6 open reading frame 108 |