Login to display prices
Login to display prices
SNX3-sorting nexin 3 Gene View larger

SNX3-sorting nexin 3 Gene

PTXBC008444

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNX3-sorting nexin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNX3-sorting nexin 3 Gene

Proteogenix catalog: PTXBC008444
Ncbi symbol: SNX3
Product name: SNX3-sorting nexin 3 Gene
Size: 2ug
Accessions: BC008444
Gene id: 8724
Gene description: sorting nexin 3
Synonyms: Grd19; MCOPS8; SDP3; sorting nexin-3; sorting nexin 3A; sorting nexin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagaccgtggctgacacccggcggctgatcaccaagccgcagaacctgaatgacgcctacggaccccccagcaacttcctcgagatcgatgtgagcaacccgcaaacggtgggggtcggccggggccgcttcaccacttacgaaatcagggtcaagacaaatcttcctattttcaagctgaaagaatctactgttagaagaagatacagtgactttgaatggctgcgaagtgaattagaaagagagagcaaggtcgtagttcccccgctccctgggaaagcgtttttgcgtcagcttccttttagaggagatgatggaatatttgatgacaattttattgaggaaagaaaacaagggctggagcagtttataaacaaggtcgctggtcatcctctggcacagaacgaacgttgtcttcacatgtttttacaagatgaaataatagataaaagctatactccatctaaaataagacatgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice