COX4NB-COX4 neighbor Gene View larger

COX4NB-COX4 neighbor Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX4NB-COX4 neighbor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COX4NB-COX4 neighbor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001472
Product type: DNA & cDNA
Ncbi symbol: COX4NB
Origin species: Human
Product name: COX4NB-COX4 neighbor Gene
Size: 2ug
Accessions: BC001472
Gene id: 10328
Gene description: COX4 neighbor
Synonyms: COX4NB; C16orf2; C16orf4; FAM158B; ER membrane protein complex subunit 8; COX4 neighbor; family with sequence similarity 158, member B; neighbor of COX4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccggggtgaaactgaccacccaggcctactgcaagatggtgctgcacggcgccaagtacccgcactgcgccgtcaacgggctcctggtggccgagaagcagaagccgcgtaaggagcacctccccctgggcggccccggcgcccaccacaccctcttcgtggactgcatccccctcttccacggcaccctggccctcgcccccatgctggaggtggctctcaccctgattgattcatggtgcaaagatcatagctacgtgattgctggttattatcaagctaatgagcgagtaaaggatgccagtccaaaccaggttgcagagaaggtggcctccagaatcgccgagggcttcagcgacactgcgctcatcatggtagacaacaccaagtttacgatggactgcgtagcgcctacgatccacgtgtacgagcaccatgagaacagatggcggtgcagagacccacaccatgactactgtgaagactggccagaggcacagaggatctcagcctcgctcctggacagccggtcctacgagacgctcgtggatttcgataaccacctggatgacattcggaatgactggacaaacccagagatcaataaagctgtcctacacttgtgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetraspanin 6
- selenoprotein I
- tetraspanin 5
- CD200 molecule

Buy COX4NB-COX4 neighbor Gene now

Add to cart