SELI-selenoprotein I Gene View larger

SELI-selenoprotein I Gene

PTXBC021229

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SELI-selenoprotein I Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SELI-selenoprotein I Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021229
Product type: DNA & cDNA
Ncbi symbol: SELI
Origin species: Human
Product name: SELI-selenoprotein I Gene
Size: 2ug
Accessions: BC021229
Gene id: 85465
Gene description: selenoprotein I
Synonyms: SELI; EPT1; SEPI; ethanolaminephosphotransferase 1; ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific); hEPT1; selenoprotein I
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggctacgaatacgtgagcccggagcagctggctggctttgataagtacaagtacagtgctgtggataccaatccactttctctgtatgtcatgcatccattctggaacactatagtaaaggtatttcctacttggctggcgcccaatctgataactttttctggctttctgctggtcgtattcaattttctgctaatggcatactttgatcctgacttttatgcctcagcaccaggtcacaagcacgtgcctgactgggtttggattgtagtgggcatcctcaacttcgtagcctacactctagatggtgtggacggaaagcaagctcgcagaaccaattctagcactcccttaggggagctttttgatcatggcctggatagttggtcatgtgtttactttgttgtgactgtttattccatctttggaagaggatcaactggtgtcagtgtttttgttctttatctcctgctatgggtagttttgttttctttcatcctgtcccactgggaaaagtataacacagggattcttttcctgccatggggatatgacattagccaggtgactatttcttttgtctacatagtgactgcagttgtgggagttgaggcctggtatgaacctttcctgtttaatttcttatatagagacctattcactgcaatgattattggttgtgcattatgtgtgactcttccaatgagtttattaaactttttcagcgtggatcctttggtcaccttcagatattttagagctacatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetraspanin 5
- CD200 molecule
- sideroflexin 3
- glutaredoxin 3

Buy SELI-selenoprotein I Gene now

Add to cart