Login to display prices
Login to display prices
GLRX3-glutaredoxin 3 Gene View larger

GLRX3-glutaredoxin 3 Gene

PTXBC005289

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLRX3-glutaredoxin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GLRX3-glutaredoxin 3 Gene

Proteogenix catalog: PTXBC005289
Ncbi symbol: GLRX3
Product name: GLRX3-glutaredoxin 3 Gene
Size: 2ug
Accessions: BC005289
Gene id: 10539
Gene description: glutaredoxin 3
Synonyms: GLRX4; GRX3; GRX4; TXNL2; TXNL3; glutaredoxin-3; PKC-interacting cousin of thioredoxin; PKC-theta-interacting protein; PKCq-interacting protein; glutaredoxin 4; testicular tissue protein Li 75; thioredoxin-like protein 2; glutaredoxin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgggggcggctgaggcagctgtagcggccgtggaggaggtcggctcagccgggcagtttgaggagctgctgcgcctcaaagccaagtccctccttgtggtccatttctgggcaccatgggctccacagtgtgcacagatgaacgaagttatggcagagttagctaaagaactccctcaagtttcatttgtgaagttggaagctgaaggtgttcctgaagtatctgaaaaatatgaaattagctctgttcccacttttctgtttttcaagaattctcagaaaatcgaccgattagatggtgcacatgccccagagttgaccaaaaaagttcagcgacatgcatctagtggctccttcctacccagcgctaatgaacatcttaaagaagatctcaaccttcgcttgaagaaattgactcatgctgccccctgcatgctgtttatgaaaggaactcctcaagaaccacgctgtggtttcagcaagcagatggtggaaattcttcacaaacataatattcagtttagcagttttgatatcttctcagatgaagaggttcgacagggactcaaagcctattccagttggcctacctatcctcagctctatgtttctggagagctcataggaggacttgatataattaaggagctagaagcatctgaagaactagatacaatttgtcccaaagctcccaaattagaggaaaggctcaaagtgctgacaaataaagcttctgtgatgctctttatgaaaggaaacaaacaggaagcaaaatgtggattcagcaaacaaattctggaaatactaaatagtactggtgttgaatatgaaacattcgatatattggaggatgaagaagttcggcaaggattaaaagcttactcaaattggccaacataccctcagctgtatgtgaaaggggagctggtgggaggattggatattgtgaaggaactgaaagaaaatggtgaattgctgcctatactgagaggagaaaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: