SNX7-sorting nexin 7 Gene View larger

SNX7-sorting nexin 7 Gene

PTXBC018105

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNX7-sorting nexin 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNX7-sorting nexin 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018105
Product type: DNA & cDNA
Ncbi symbol: SNX7
Origin species: Human
Product name: SNX7-sorting nexin 7 Gene
Size: 2ug
Accessions: BC018105
Gene id: 51375
Gene description: sorting nexin 7
Synonyms: sorting nexin-7; sorting nexin 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacatgaactccttcagccctatgatgccaacatcccctttatcaatgataaaccaaatcaagtttgaggatgaaccagatttaaaggatctcttcatcacagttgatgaacctgaaagtcatgttactacaatagaaactttcattacgtataggattattactaagacatctcgtggggaatttgactccagtgaatttgaagttaggagacgatatcaagatttcctttggttgaagggaaaactggaagaagcacaccccactctgattattccaccattgccagaaaagtttatagtaaaaggaatggtggaacgctttaacgatgacttcattgagacacgcaggaaggctttacataaatttttgaaccgaattgctgatcatccaactttaacatttaatgaagacttcaaaatttttctcactgcacaagcttgggaactctcttctcacaagaagcaaggtcctggcttgctaagcaggatggggcaaaccgtcagagctgttgcgtcctcaatgagaggagttaaaaaccgcccagaggagttcatggaaatgaataactttattgaactatttagccagaaaataaatttgatagataaaatatctcagagaatttataaggaagaaagggaatattttgatgaaatgaaagaatatggcccaattcatattctgtggtcagcgtcagaagaggatctggttgatactctaaaggatgttgccagctgcattgacagatgctgtaaggccactgaaaagcggatgtctggactctcagaggccctgcttcctgttgtacatgagtacgtgctttatagtgaaatgttaatgggtgttatgaaaagaagagaccaaatacaagcagaactggattccaaagttgaagttttgacctataaaaaggcagatactgatctgtgccttgctacgtgggaatcattccttacatcacagaccaaccttcacttggaagaagcctctgaagataaaccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tropomodulin 1
- calreticulin 3
- actin-like 7B
- actin-like 6A

Buy SNX7-sorting nexin 7 Gene now

Add to cart