Login to display prices
Login to display prices
ACTL6A-actin-like 6A Gene View larger

ACTL6A-actin-like 6A Gene

PTXBC036371

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTL6A-actin-like 6A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACTL6A-actin-like 6A Gene

Proteogenix catalog: PTXBC036371
Ncbi symbol: ACTL6A
Product name: ACTL6A-actin-like 6A Gene
Size: 2ug
Accessions: BC036371
Gene id: 86
Gene description: actin-like 6A
Synonyms: ACTL6; ARPN-BETA; Arp4; BAF53A; INO80K; actin-like protein 6A; 53 kDa BRG1-associated factor A; BAF complex 53 kDa subunit; BAF53; BRG1-associated factor 53A; INO80 complex subunit K; actin-related protein 4; actin-related protein Baf53a; arpNbeta; hArpN beta; actin like 6A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcggcggcgtgtacgggggagatgaagttggagcccttgtttttgacattggatcctatactgtgagagctggttatgctggtgaggactgccccaaggtggattttcctacagctattggtatggtggtagaaagagatgacggaagcacattaatggaaatagatggcgataaaggcaaacaaggcggtcccacctactacatagatactaatgctctgcgtgttccgagggagaatatggaggccatttcacctctaaaaaatgggatggttgaagactgggatagtttccaagctattttggatcatacctacaaaatgcatgtcaaatcagaagccagtctccatcctgttctcatgtcagaggcaccgtggaatactagagcaaagagagagaaactgacagagttaatgtttgaacactacaacatccctgccttcttcctttgcaaaactgcagttttgacagcatttgctaatggtcgttctactgggctgattttggacagtggagccactcataccactgcaattccagtccacgatggctatgtccttcaacaaggcattgtgaaatcccctcttgctggagactttattactatgcagtgcagagaactcttccaagaaatgaatattgaattggttcctccatatatgattgcatcaaaagaagctgttcgtgaaggatctccagcaaactggaaaagaaaagagaagttgcctcaggttacgaggtcttggcacaattatatgtgtaattgtgttatccaggattttcaagcttcggtacttcaagtgtcagattcaacttatgatgaacaagtggctgcacagatgccaactgttcattatgaattccccaatggctacaattgtgattttggtgcagagcggctaaagattccagaaggattatttgacccttccaatgtaaaggggttatcaggaaacacaatgttaggagtcagtcatgttgtcaccacaagtgttgggatgtgtgatattgacatcagaccaggtctctatggcagtgtaatagtggcaggaggaaacacactaatacagagttttactgacaggttgaatagagagctgtctcagaaaactcctccaagtatgcggttgaaattgattgcaaataatacaacagtggaacggaggtttagctcatggattggcggctccattctagcctctttgggtacctttcaacagatgtggatttccaagcaagaatatgaagaaggagggaagcagtgtgtagaaagaaaatgcccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: