ACTL7A-actin-like 7A Gene View larger

ACTL7A-actin-like 7A Gene

PTXBC014610

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTL7A-actin-like 7A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACTL7A-actin-like 7A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014610
Product type: DNA & cDNA
Ncbi symbol: ACTL7A
Origin species: Human
Product name: ACTL7A-actin-like 7A Gene
Size: 2ug
Accessions: BC014610
Gene id: 10881
Gene description: actin-like 7A
Synonyms: actin-like protein 7A; actin-like 7-alpha; testicular secretory protein Li 3; actin like 7A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggctccaccagcagcaatcatgggggatgggcccaccaagaaggtgggcaaccaggcccccctgcagacacaggccctccagactgcctctttaagggatggcccggcgaagcgggccgtgtgggtccgccatacgagttcagagccacaagaacctactgaatcaaaggcagccaaggagaggcccaagcaggaggtgaccaaagcagtggtcgtggacctgggcactggctactgtaaatgtggctttgccggcctgccaagacccacccacaagatctcaacaacggtgggcaagccctacatggagaccgccaagactggggataatcgcaaggagacattcgtggggcaggaactcaacaacacaaacgttcatctcaagctggttaaccctctgcgacatggcatcatcgtggactgggatacagtgcaggatatctgggaatatctcttccgacaagagatgaagatcgccccggaggagcatgcggtcttggtttcagacccgccactgagcccacacaccaacagagagaaatatgctgaaatgctgtttgaagccttcaacacccctgcaatgcacatcgcctaccagtcgcgcctgtccatgtactcctatggaaggacctccggcctggtggtggaggtgggccatggcgtgtcctacgtggtccccatctacgagggttatcctttgcccagcatcaccggaaggctggactacgcgggctctgacctgacagcctacctgctgggcctgctgaacagtgcggggaacgaattcacccaggaccagatgggcatcgtggaggacatcaagaagaaatgctgctttgtggccctggatcccattgaggagaagaaagtccctctcagtgagcatacgatccgctacgtgctgccggatgggaaggagattcagctgtgccaggaacggttcctctgctcggagatgttcttcaagccatctctcatcaagtccatgcagctgggcctccacacccaaaccgtgtcctgccttaacaagtgtgacatcgccctcaaacgggacctcatggggaacatcctgctctgcgggggcagcacgatgctcagtggcttccctaaccgtctgcagaaggagctaagcagcatgtgtcccaatgacaccccgcaggtaaacgtgctgcctgaaagagacagtgccgtgtggaccggtggctccatcctggcctcacttcagggtttccaaccattatgggtccaccgctttgagtacgaggaacacgggcctttcttcctctacagaaggtgcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small ArfGAP 1
- olfactomedin 3
- sorting nexin 8
- arylsulfatase A

Buy ACTL7A-actin-like 7A Gene now

Add to cart