Login to display prices
Login to display prices
SFXN3-sideroflexin 3 Gene View larger

SFXN3-sideroflexin 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFXN3-sideroflexin 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SFXN3-sideroflexin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000124
Product type: DNA & cDNA
Ncbi symbol: SFXN3
Origin species: Human
Product name: SFXN3-sideroflexin 3 Gene
Size: 2ug
Accessions: BC000124
Gene id: 81855
Gene description: sideroflexin 3
Synonyms: BA108L7.2; SFX3; sideroflexin-3; sideroflexin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaagcaaaatgggtgaattgcctttagacatcaacatccaggaacctcgctgggaccaaagtactttcctgggcagagcccggcactttttcactgttactgatcctcgaaatctgctgctgtccggggcacagctggaagcttctcggaacatcgtgcagaactacagggccggcgtggtgaccccagggatcaccgaggaccagctgtggagggccaagtatgtgtatgactccgccttccatccggacacaggggagaaggtggtcctgattggccgcatgtcagcccaggtgcccatgaacatgaccatcactggctgcatgctcacattctacaggaagaccccaaccgtggtgttctggcagtgggtgaatcagtccttcaatgccattgttaactactccaaccgcagtggtgacactcccatcactgtgaggcagctggggacagcctatgtgagtgccaccactggagctgtggccacggccctgggactcaaatccctcaccaagcacctgccccccttggtcggcagatttgtgccctttgcagcagtggcagctgccaactgcatcaacatccccctgatgaggcagagagagctgcaggtgggcatcccggtggctgatgaggcaggtcagaggcttggctactcggtgactgcagccaagcagggaatcttccaggtggtgatttcaagaatctgcatggcgattcctgccatggccatcccaccactgatcatggacactctggagaagaaagacttcctgaagcgccgcccctggctgggggcacccctgcaggtgggactggtgggcttctgcctggtatttgcaacccccctgtgctgtgccctattcccccagaagagctccatacacataagcaacctggaaccagagctgagagctcagatccatgagcaaaaccccagcgttgaagtggtctactacaacaaggggctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutaredoxin 3
- sorting nexin 7
- tropomodulin 1
- calreticulin 3