CERK-ceramide kinase Gene View larger

CERK-ceramide kinase Gene

PTXBC004278

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CERK-ceramide kinase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CERK-ceramide kinase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004278
Product type: DNA & cDNA
Ncbi symbol: CERK
Origin species: Human
Product name: CERK-ceramide kinase Gene
Size: 2ug
Accessions: BC004278
Gene id: 64781
Gene description: ceramide kinase
Synonyms: LK4; dA59H18.2; dA59H18.3; hCERK; ceramide kinase; acylsphingosine kinase; lipid kinase 4; lipid kinase LK4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaacgtggccctgcttcaggtgatccgcgggaggggcctccacgccagcgccgggaaggctgctggggcctccacacctgcctcatcacggcggcgaggctacgacaatccggctgggagcatgaccttggcgtctgttctgggagcacggatgataagctctggaagctggcagtgtgtaaagcactggcaagtttgttactgttaaaatgtcaaataccaatgctttatatcgacgcgaagtgcttaacacagccgggcttgggggcagtcaggaggaagctggccatccgtggaggaggggccggtcctggactcccgcaggactcctctgaggcagggcctgaagtctgtacacgtggtccagatttgtccttgtcttttcttcacactgagttctctatatttattgaacatcttgtccttttaagccagagtagtgtaaactgcgtctcggatgtctgtcttttgcctcgaagccacgatggatcgctggtttcctctgcagcgcgagggctccggcgaccagaggattcttcccggaaggcattcctgccgcgctccccggggcacccctcaattgtgtactacgtccttgtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - COX4 neighbor
- tetraspanin 6
- selenoprotein I
- tetraspanin 5

Buy CERK-ceramide kinase Gene now

Add to cart