PTXBC005324
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005324 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNASE1 |
| Origin species: | Human |
| Product name: | RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene |
| Size: | 2ug |
| Accessions: | BC005324 |
| Gene id: | 6035 |
| Gene description: | ribonuclease, RNase A family, 1 (pancreatic) |
| Synonyms: | RAC1; RIB1; RNS1; ribonuclease pancreatic; HP-RNase; RIB-1; RNase 1; RNase A; RNase upI-1; ribonuclease 1; ribonuclease A C1; ribonuclease, RNase A family, 1 (pancreatic); ribonuclease A family member 1, pancreatic |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctctggagaagtctcttgtccggctccttctgcttgtcctgatactgctggtgctgggctgggtccagccttccctgggcaaggaatcccgggccaagaaattccagcggcagcatatggactcagacagttcccccagcagcagctccacctactgtaaccaaatgatgaggcgccggaatatgacacaggggcggtgcaaaccagtgaacacctttgtgcacgagcccctggtagatgtccagaatgtctgtttccaggaaaaggtcacctgcaagaacgggcagggcaactgctacaagagcaactccagcatgcacatcacagactgccgcctgacaaacggctccaggtaccccaactgtgcataccggaccagcccgaaggagagacacatcattgtggcctgtgaagggagcccatatgtgccagtccactttgatgcttctgtggaggactctacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - neuroblastoma, suppression of tumorigenicity 1 - family with sequence similarity 98, member C - MAD2 mitotic arrest deficient-like 2 (yeast) - family with sequence similarity 54, member A |