RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene View larger

RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005324
Product type: DNA & cDNA
Ncbi symbol: RNASE1
Origin species: Human
Product name: RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene
Size: 2ug
Accessions: BC005324
Gene id: 6035
Gene description: ribonuclease, RNase A family, 1 (pancreatic)
Synonyms: RAC1; RIB1; RNS1; ribonuclease pancreatic; HP-RNase; RIB-1; RNase 1; RNase A; RNase upI-1; ribonuclease 1; ribonuclease A C1; ribonuclease, RNase A family, 1 (pancreatic); ribonuclease A family member 1, pancreatic
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctggagaagtctcttgtccggctccttctgcttgtcctgatactgctggtgctgggctgggtccagccttccctgggcaaggaatcccgggccaagaaattccagcggcagcatatggactcagacagttcccccagcagcagctccacctactgtaaccaaatgatgaggcgccggaatatgacacaggggcggtgcaaaccagtgaacacctttgtgcacgagcccctggtagatgtccagaatgtctgtttccaggaaaaggtcacctgcaagaacgggcagggcaactgctacaagagcaactccagcatgcacatcacagactgccgcctgacaaacggctccaggtaccccaactgtgcataccggaccagcccgaaggagagacacatcattgtggcctgtgaagggagcccatatgtgccagtccactttgatgcttctgtggaggactctacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuroblastoma, suppression of tumorigenicity 1
- family with sequence similarity 98, member C
- MAD2 mitotic arrest deficient-like 2 (yeast)
- family with sequence similarity 54, member A

Buy RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene now

Add to cart