Login to display prices
Login to display prices
RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene View larger

RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene

PTXBC005324

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene

Proteogenix catalog: PTXBC005324
Ncbi symbol: RNASE1
Product name: RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene
Size: 2ug
Accessions: BC005324
Gene id: 6035
Gene description: ribonuclease, RNase A family, 1 (pancreatic)
Synonyms: RAC1; RIB1; RNS1; ribonuclease pancreatic; HP-RNase; RIB-1; RNase 1; RNase A; RNase upI-1; ribonuclease 1; ribonuclease A C1; ribonuclease, RNase A family, 1 (pancreatic); ribonuclease A family member 1, pancreatic
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctggagaagtctcttgtccggctccttctgcttgtcctgatactgctggtgctgggctgggtccagccttccctgggcaaggaatcccgggccaagaaattccagcggcagcatatggactcagacagttcccccagcagcagctccacctactgtaaccaaatgatgaggcgccggaatatgacacaggggcggtgcaaaccagtgaacacctttgtgcacgagcccctggtagatgtccagaatgtctgtttccaggaaaaggtcacctgcaagaacgggcagggcaactgctacaagagcaactccagcatgcacatcacagactgccgcctgacaaacggctccaggtaccccaactgtgcataccggaccagcccgaaggagagacacatcattgtggcctgtgaagggagcccatatgtgccagtccactttgatgcttctgtggaggactctacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice