Login to display prices
Login to display prices
MAX-MYC associated factor X Gene View larger

MAX-MYC associated factor X Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAX-MYC associated factor X Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAX-MYC associated factor X Gene

Proteogenix catalog: PTXBC003525
Ncbi symbol: MAX
Product name: MAX-MYC associated factor X Gene
Size: 2ug
Accessions: BC003525
Gene id: 4149
Gene description: MYC associated factor X
Synonyms: protein max; bHLHd4; class D basic helix-loop-helix protein 4; MYC associated factor X
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgataacgatgacatcgaggtggagagcgacgctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatcccgggcccaaatcctagacaaagccacagaatatatccagtatatgcgaaggaaaaaccacacacaccagcaagatattgacgacctcaagcggcagaatgctcttctggagcagcaagtccgtgcactggagaaggcgaggtcaagtgcccaactgcagaccaactacccctcctcagacaacagcctctacaccaacgccaagggcagcaccatctctgccttcgatgggggctcggactccagctcggagtctgagcctgaagagccccaaagcaggaagaagctccggatggaggccagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice