RPS14-ribosomal protein S14 Gene View larger

RPS14-ribosomal protein S14 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS14-ribosomal protein S14 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS14-ribosomal protein S14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001126
Product type: DNA & cDNA
Ncbi symbol: RPS14
Origin species: Human
Product name: RPS14-ribosomal protein S14 Gene
Size: 2ug
Accessions: BC001126
Gene id: 6208
Gene description: ribosomal protein S14
Synonyms: EMTB; S14; 40S ribosomal protein S14; emetine resistance; ribosomal protein S14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacctcgaaaggggaaggaaaagaaggaagaacaggtcatcagcctcggacctcaggtggctgaaggagagaatgtatttggtgtctgccatatctttgcatccttcaatgacacttttgtccatgtcactgatctttctggcaaggaaaccatctgccgtgtgactggtgggatgaaggtaaaggcagaccgagatgaatcctcaccatatgctgctatgttggctgcccaggatgtggcccagaggtgcaaggagctgggtatcaccgccctacacatcaaactccgggccacaggaggaaataggaccaagacccctggacctggggcccagtcggccctcagagcccttgcccgctcgggtatgaagatcgggcggattgaggatgtcacccccatcccctctgacagcactcgcaggaaggggggtcgccgtggtcgccgtctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MYC associated factor X
- MYC associated factor X
- cofilin 1 (non-muscle)
- titin-cap (telethonin)

Buy RPS14-ribosomal protein S14 Gene now

Add to cart