Login to display prices
Login to display prices
GYPA-glycophorin A (MNS blood group) Gene View larger

GYPA-glycophorin A (MNS blood group) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GYPA-glycophorin A (MNS blood group) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GYPA-glycophorin A (MNS blood group) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005319
Product type: DNA & cDNA
Ncbi symbol: GYPA
Origin species: Human
Product name: GYPA-glycophorin A (MNS blood group) Gene
Size: 2ug
Accessions: BC005319
Gene id: 2993
Gene description: glycophorin A (MNS blood group)
Synonyms: CD235a; GPA; GPErik; GPSAT; HGpMiV; HGpMiXI; HGpSta(C); MNS; PAS-2; glycophorin-A; MN sialoglycoprotein; Mi.V glycoprotein (24 AA); erythroid-lineage-specific membrane sialoglycoprotein; glycophorin A (MN blood group); glycophorin A, GPA; glycophorin Erik; glycophorin MiI; glycophorin MiV; glycophorin SAT; glycophorin Sta type C; recombinant glycophorin A-B Miltenberger-DR; sialoglycoprotein alpha; glycophorin A (MNS blood group)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtatggaaaaataatctttgtattactattgtcagcaattgtgagcatatcagcattaagtaccactgaggtggcaatgcacacttcaacctcttcttcagtcacaaagagttacatctcatcacagacaaatgatacgcacaaacgggacacatatgcagccactcctagagctcatgaagtttcagaaatttctgttagaactgtttaccctccagaagaggaaaccggagaaagggtacaacttgcccatcatttctctgaaccagagataacactcattatttttggggtgatggctggtgttattggaacgatcctcttaatttcttacggtattcgccgactgataaagaaaagcccatctgatgtaaaacctctcccctcacctgacacagacgtgcctttaagttctgttgaaatagaaaatccagagacaagtgatcaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - natriuretic peptide precursor A
- hypothetical protein MGC12972
- methylphosphate capping enzyme
- unc-84 homolog A (C. elegans)