Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of NPPA-natriuretic peptide precursor A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NPPA-natriuretic peptide precursor A Gene
| Proteogenix catalog: | PTXBC005893 |
| Ncbi symbol: | NPPA |
| Product name: | NPPA-natriuretic peptide precursor A Gene |
| Size: | 2ug |
| Accessions: | BC005893 |
| Gene id: | 4878 |
| Gene description: | natriuretic peptide precursor A |
| Synonyms: | ANF; ANP; ATFB6; ATRST2; CDD; CDD-ANF; CDP; PND; natriuretic peptides A; atriopeptin; cardiodilatin-related peptide; cardionatrin; natriuretic peptide precursor A variant 1; prepronatriodilatin; natriuretic peptide A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctccttctccaccaccaccgtgagcttcctccttttactggcattccagctcctaggtcagaccagagctaatcccatgtacaatgccgtgtccaacgcagacctgatggatttcaagaatttgctggaccatttggaagaaaagatgcctttagaagatgaggtcgtgcccccacaagtgctcagtgagccgaatgaagaagcgggggctgctctcagccccctccctgaggtgcctccctggaccggggaagtcagcccagcccagagagatggaggtgccctcgggcggggcccctgggactcctctgatcgatctgccctcctaaaaagcaagctgagggcgctgctcactgcccctcggagcctgcggagatccagctgcttcgggggcaggatggacaggattggagcccagagcggactgggctgtaacagcttccggtaccgaagataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |