Login to display prices
Login to display prices
NPPA-natriuretic peptide precursor A Gene View larger

NPPA-natriuretic peptide precursor A Gene

PTXBC005893

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NPPA-natriuretic peptide precursor A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NPPA-natriuretic peptide precursor A Gene

Proteogenix catalog: PTXBC005893
Ncbi symbol: NPPA
Product name: NPPA-natriuretic peptide precursor A Gene
Size: 2ug
Accessions: BC005893
Gene id: 4878
Gene description: natriuretic peptide precursor A
Synonyms: ANF; ANP; ATFB6; ATRST2; CDD; CDD-ANF; CDP; PND; natriuretic peptides A; atriopeptin; cardiodilatin-related peptide; cardionatrin; natriuretic peptide precursor A variant 1; prepronatriodilatin; natriuretic peptide A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctccttctccaccaccaccgtgagcttcctccttttactggcattccagctcctaggtcagaccagagctaatcccatgtacaatgccgtgtccaacgcagacctgatggatttcaagaatttgctggaccatttggaagaaaagatgcctttagaagatgaggtcgtgcccccacaagtgctcagtgagccgaatgaagaagcgggggctgctctcagccccctccctgaggtgcctccctggaccggggaagtcagcccagcccagagagatggaggtgccctcgggcggggcccctgggactcctctgatcgatctgccctcctaaaaagcaagctgagggcgctgctcactgcccctcggagcctgcggagatccagctgcttcgggggcaggatggacaggattggagcccagagcggactgggctgtaacagcttccggtaccgaagataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice