Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UNC84A-unc-84 homolog A (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UNC84A-unc-84 homolog A (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013613 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UNC84A |
| Origin species: | Human |
| Product name: | UNC84A-unc-84 homolog A (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC013613 |
| Gene id: | 23353 |
| Gene description: | unc-84 homolog A (C. elegans) |
| Synonyms: | UNC84A; SUN domain-containing protein 1; Sad1 unc-84 domain protein 1; protein unc-84 homolog A; sad1/unc-84 protein-like 1; unc-84 homolog A; Sad1 and UNC84 domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatttttctcggcttcacatgtacagtcctccccagtgtgtgccggagaacacgggctacacgtatgcgctcagttccagctattcttcagatgctctggattttgagacggagcacaaattggaccctgtatttgattctccacggatgtcccgccgtagtttgcgcctggccacgacagcatgcaccctgggggatggtgaggctgtgggtgccgacagcggcaccagcagcgctgtctccctgaagaaccgagcggccagaacaacaaaacagcgcagaagcacaaacaaatcagcttttagtatcaaccacgtgtcaaggcaggtcacgtcctctggcgtcagccacggcggcactgtcagcctgcaggatgctgtgactcgacggcctcctgtattggacgagtcttggattcgtgaacagaccacagtggaccacttctggggtcttgatgatgatggtgatcttaaaggtggaaataaagctgccattcagggaaacggggatgtgggagccgccgccgccaccgcgcacaacggcttctcctgcagcaactgcagcatgctgtccgagcgcaaggacgtgctcacggcgcaccccgcgccccccgggcccgtgtcgagagtttattctagggacaggaatcaaaaatgtaagtctcagtcctttaaaactcagaaaaaggtgtgttttccaaatttaatatttcctttctgtaagtctcagtgtctgcactatttgtcttggagacttaaaattatcccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TGFB-induced factor homeobox 1 - peroxisomal biogenesis factor 7 - PHD finger protein 20-like 1 - glioblastoma amplified sequence |