Login to display prices
Login to display prices
UNC84A-unc-84 homolog A (C. elegans) Gene View larger

UNC84A-unc-84 homolog A (C. elegans) Gene

PTXBC013613

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UNC84A-unc-84 homolog A (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UNC84A-unc-84 homolog A (C. elegans) Gene

Proteogenix catalog: PTXBC013613
Ncbi symbol: UNC84A
Product name: UNC84A-unc-84 homolog A (C. elegans) Gene
Size: 2ug
Accessions: BC013613
Gene id: 23353
Gene description: unc-84 homolog A (C. elegans)
Synonyms: UNC84A; SUN domain-containing protein 1; Sad1 unc-84 domain protein 1; protein unc-84 homolog A; sad1/unc-84 protein-like 1; unc-84 homolog A; Sad1 and UNC84 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatttttctcggcttcacatgtacagtcctccccagtgtgtgccggagaacacgggctacacgtatgcgctcagttccagctattcttcagatgctctggattttgagacggagcacaaattggaccctgtatttgattctccacggatgtcccgccgtagtttgcgcctggccacgacagcatgcaccctgggggatggtgaggctgtgggtgccgacagcggcaccagcagcgctgtctccctgaagaaccgagcggccagaacaacaaaacagcgcagaagcacaaacaaatcagcttttagtatcaaccacgtgtcaaggcaggtcacgtcctctggcgtcagccacggcggcactgtcagcctgcaggatgctgtgactcgacggcctcctgtattggacgagtcttggattcgtgaacagaccacagtggaccacttctggggtcttgatgatgatggtgatcttaaaggtggaaataaagctgccattcagggaaacggggatgtgggagccgccgccgccaccgcgcacaacggcttctcctgcagcaactgcagcatgctgtccgagcgcaaggacgtgctcacggcgcaccccgcgccccccgggcccgtgtcgagagtttattctagggacaggaatcaaaaatgtaagtctcagtcctttaaaactcagaaaaaggtgtgttttccaaatttaatatttcctttctgtaagtctcagtgtctgcactatttgtcttggagacttaaaattatcccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: