FKSG24-hypothetical protein MGC12972 Gene View larger

FKSG24-hypothetical protein MGC12972 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FKSG24-hypothetical protein MGC12972 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FKSG24-hypothetical protein MGC12972 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005064
Product type: DNA & cDNA
Ncbi symbol: FKSG24
Origin species: Human
Product name: FKSG24-hypothetical protein MGC12972 Gene
Size: 2ug
Accessions: BC005064
Gene id: 84769
Gene description: hypothetical protein MGC12972
Synonyms: FKSG24; mpv17-like protein 2; MPV17 mitochondrial membrane protein-like 2; MPV17 mitochondrial inner membrane protein like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcggggtggctggcgccggctacgccgcctgttatccgcggggcagcttctattccagggccgcgcgctgctcgtcactaacacgctgggctgcggcgcgctcatggcggccggtgatggcgtgcgccagtcctgggagatccgcgcccggcccggccaggttttcgacccacggcgctccgcgagcatgtttgcggtgggctgcagcatgggtcccttcctgcactactggtacttgtcgctggaccgcctattccctgcgtctggcctccgaggcttcccaaatgtcctcaagaaggtcctcgtggatcagctggtagcctctccattgctgggcgtctgggaattctacaaggcagactggtgcgtgtggcctgctgcgcagttcgtgaacttcctcttcgtgcccccccaatttcgagtcacctacatcaacggcctgacgctgggctgggacacgtacctgtcctacttgaagtaccggagcccagttcctctgacacccccaggctgtgtggccctggacacccgagcagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methylphosphate capping enzyme
- unc-84 homolog A (C. elegans)
- TGFB-induced factor homeobox 1
- peroxisomal biogenesis factor 7

Buy FKSG24-hypothetical protein MGC12972 Gene now

Add to cart