Login to display prices
Login to display prices
MYL1-myosin, light chain 1, alkali, skeletal, fast Gene View larger

MYL1-myosin, light chain 1, alkali, skeletal, fast Gene

PTXBC005318

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYL1-myosin, light chain 1, alkali, skeletal, fast Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYL1-myosin, light chain 1, alkali, skeletal, fast Gene

Proteogenix catalog: PTXBC005318
Ncbi symbol: MYL1
Product name: MYL1-myosin, light chain 1, alkali, skeletal, fast Gene
Size: 2ug
Accessions: BC005318
Gene id: 4632
Gene description: myosin, light chain 1, alkali; skeletal, fast
Synonyms: MLC1F; MLC3F; myosin light chain 1/3, skeletal muscle isoform; A1 catalytic; A2 catalytic; MLC1/MLC3; MLC1F/MLC3F; myosin light chain A1/A2; myosin light chain alkali 1/2; myosin, light chain 1, alkali; skeletal, fast; myosin, light polypeptide 1, alkali; skeletal, fast; myosin light chain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccttcagtgctgaccagattgctgaattcaaggaggcatttctcctgtttgacagaacaggtgattccaagatcaccttaagccaggtcggtgatgtccttcgagctctgggcacaaatcccaccaatgcagaggtcaggaaagttctgggaaaccccagcaatgaagagctgaatgccaagaaaattgagtttgaacaatttctgcctatgatgcaagccatttccaacaacaaggaccaggccacctatgaagactttgttgagggtctgcgtgtctttgacaaggaaggcaatggcacagtcatgggtgctgaactccgccatgttctagccaccctgggtgaaaagatgaaagaggaagaagtggaagccctgatggcaggtcaagaagactccaatggctgcatcaactacgaagcttttgtcaagcacatcatgtctatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice