Login to display prices
Login to display prices
AHNAK-AHNAK nucleoprotein Gene View larger

AHNAK-AHNAK nucleoprotein Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AHNAK-AHNAK nucleoprotein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AHNAK-AHNAK nucleoprotein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012477
Product type: DNA & cDNA
Ncbi symbol: AHNAK
Origin species: Human
Product name: AHNAK-AHNAK nucleoprotein Gene
Size: 2ug
Accessions: BC012477
Gene id: 79026
Gene description: AHNAK nucleoprotein
Synonyms: AHNAK nucleoprotein; AHNAK-related; neuroblast differentiation-associated protein AHNAK; AHNAKRS; PM227; desmoyokin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaggaggagacaacccgggagctgctgctgcccaactggcagggtagtggctcccacgggctgaccatcgcccagagggacgacggcgtctttgtgcaggaggtgacgcagaactcccctgcggcccgcactggggtggtcaaggagggggaccagattgtgggtgccaccatctactttgacaacctgcagtcgggtgaggtgacccagctgctgaacaccatggggcaccacacggtgggcctgaagctgcaccgcaagggggaccgctctcccgagcctggccagacctggacccgtgaagtcttcagctcctgcagctctgaagtgtttctgaacacaccacagccatcagcactggaatgcaaagaccagaacaaacagaaggaagccagcagccaagccggggcagtttcagtctccaccccaaatgcaggactgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L9
- hippocalcin-like 1
- ribosomal protein S5
- Coenzyme A synthase