HPCAL1-hippocalcin-like 1 Gene View larger

HPCAL1-hippocalcin-like 1 Gene

PTXBC009846

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HPCAL1-hippocalcin-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HPCAL1-hippocalcin-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009846
Product type: DNA & cDNA
Ncbi symbol: HPCAL1
Origin species: Human
Product name: HPCAL1-hippocalcin-like 1 Gene
Size: 2ug
Accessions: BC009846
Gene id: 3241
Gene description: hippocalcin-like 1
Synonyms: BDR1; HLP2; VILIP-3; hippocalcin-like protein 1; calcium-binding protein BDR-1; visinin-like protein 3; hippocalcin like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaaacagaacagcaagctgcggcccgaggtgctgcaggacctgcgggagaacacggagttcaccgaccacgagctgcaggagtggtacaagggcttcctcaaggactgccccaccggccacctgaccgtggacgagttcaagaagatctacgccaacttcttcccctacggcgacgcttccaagttcgccgagcacgtcttccgcaccttcgacaccaacggcgacggcaccatcgacttccgggagttcatcattgcgctgagcgtgacctcgcggggcaagctggagcagaagctcaagtgggccttcagcatgtacgacctggacggcaacggctacatcagccgcagcgagatgctggagatcgtgcaggccatctacaagatggtgtcgtctgtgatgaagatgccggaggatgagtccaccccggagaagcgcacagacaagatcttcaggcagatggacaccaacaatgacggcaaactgtccttggaagaattcatcagaggtgccaagagcgacccctccatcgtccgcctgctgcagtgcgaccccagcagtgccagtcagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S5
- Coenzyme A synthase
- ribosomal protein L3
- carbonyl reductase 4

Buy HPCAL1-hippocalcin-like 1 Gene now

Add to cart