COASY-Coenzyme A synthase Gene View larger

COASY-Coenzyme A synthase Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COASY-Coenzyme A synthase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COASY-Coenzyme A synthase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006354
Product type: DNA & cDNA
Ncbi symbol: COASY
Origin species: Human
Product name: COASY-Coenzyme A synthase Gene
Size: 2ug
Accessions: BC006354
Gene id: 80347
Gene description: Coenzyme A synthase
Synonyms: DPCK; NBIA6; NBP; PPAT; UKR1; pOV-2; bifunctional coenzyme A synthase; CoA synthase; bifunctional phosphopantetheine adenylyl transferase/dephospho CoA kinase; nucleotide binding protein; phosphopantetheine adenylyltransferase / dephosphocoenzyme A kinase; Coenzyme A synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttggggaacctgcttcggcctccatatgaaaggccagagctccccacatgtctctatgtaattgggctgactggcatcagtggctctgggaagagctcaatagctcagcgactgaagggcctgggggcgtttgtcattgacagtgaccacctgggtcatcgggcctatgccccaggtggccctgcctaccagcctgtggtggaggcctttggaacagatattctccataaagatggcatcatcaacaggaaggtcctaggcagccgggtgtttgggaataagaagcagctgaagatactcacggacattatgtggccaattatcgcaaagctggcccgagaggagatggatcgggctgtggctgagggaaagcgtgtgtgtgtgattgatgccgctgtgttgcttgaagccggctggcagaacctggtccatgaggtgtggactgctgtcatcccagagactgaggctgtaagacgcattgtggagagggatggcctcagtgaagccgcggctcaaagccggctgcagagccagatgagcgggcagcagcttgtggaacagagccacgtggtgctcagcaccttgtgggagccgcatatcacccaacgccaggtggagaaagcctgggccctcttgcagaagcgcattcccaagactcatcaggccctcgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L3
- carbonyl reductase 4
- ribosomal protein S3
- phosphomannomutase 2

Buy COASY-Coenzyme A synthase Gene now

Add to cart