PMM2-phosphomannomutase 2 Gene View larger

PMM2-phosphomannomutase 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PMM2-phosphomannomutase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PMM2-phosphomannomutase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008310
Product type: DNA & cDNA
Ncbi symbol: PMM2
Origin species: Human
Product name: PMM2-phosphomannomutase 2 Gene
Size: 2ug
Accessions: BC008310
Gene id: 5373
Gene description: phosphomannomutase 2
Synonyms: CDG1; CDG1a; CDGS; PMI; PMI1; PMM 2; phosphomannomutase 2; mannose-6-phosphate isomerase; phosphomannose isomerase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcgcctggcccagcgctctgcctcttcgacgtggatgggaccctcaccgccccgcggcagaaaattaccaaagaaatggatgacttcctacaaaaattgaggcagaagatcaaaatcggagtggtaggcggatcggactttgagaaagtgcaggagcaactgggaaatgatgtggttgaaaaatacgattatgtgtttccagaaaatggcttggtagcatacaaagatgggaaactcttgtgtagacagaatattcaaagtcatctgggtgaggccctaatccaagatttaatcaactactgtctgagctacattgcgaaaattaaactcccgaagaagaggggtactttcattgaattccgaaatgggatgttaaacgtgtcccctattggaagaagctgcagccaagaagaacgcattgagttctacgaactcgataaaaaagaaaatataagacaaaagtttgtagcagatctacggaaagagtttgctggaaaaggcctcacgttttccataggaggccagatcagctttgatgtctttcctgatggatgggacaagagatactgtctgcgacatgtggaaaatgacggttataagaccatttatttctttggagacaaaactatgccaggtggcaatgaccatgagatcttcacagaccccagaaccatgggctactccgtgacagcgcctgaggacacgcgcaggatctgtgaactgctgttctcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L8
- carbonic anhydrase II
- phosphomannomutase 1
- WD repeat domain 37

Buy PMM2-phosphomannomutase 2 Gene now

Add to cart