RPL8-ribosomal protein L8 Gene View larger

RPL8-ribosomal protein L8 Gene

PTXBC012197

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL8-ribosomal protein L8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL8-ribosomal protein L8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012197
Product type: DNA & cDNA
Ncbi symbol: RPL8
Origin species: Human
Product name: RPL8-ribosomal protein L8 Gene
Size: 2ug
Accessions: BC012197
Gene id: 6132
Gene description: ribosomal protein L8
Synonyms: 60S ribosomal protein L8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccgtgtgatccgtggacagaggaagggcgccgggtctgtgttccgcgcgcacgtgaagcaccgtaaaggcgctgcgcgcctgcgcgccgtggatttcgctgagcggcacggctacatcaagggcatcgtcaaggacatcatccacgacccgggccgcggcgcgcccctcgccaaggtggtcttccgggatccgtatcggtttaagaagcggacggagctgttcattgccgccgagggcattcacacgggccagtttgtgtattgcggcaagaaggcccagctcaacgttggcaatgtgctccctgtgggcaccatgcctgagggtacaatcgtgtgctgcctggaggagaagcctggagaccgtggcaagctggcccgggcatcagggaactatgccaccgttatctcccacaaccctgagaccaagaagacccgtgtgaagctgccctccggctccaagaaggttatctcctcagccaacagagctgtggttggtgtggtggctggaggtggccgaattgacaaacccatcttgaaggctggccgggcgtaccacaaatataaggcaaagaggaactgctggccacgagtacggggtgtggccatgaatcctgtggagcatccttttggaggtggcaaccaccagcacatcggcaagccctccaccatccgcagagatgcccctgctggccgcaaagtgggtctcattgctgcccgccggactggacgtctccggggaaccaagactgtgcaggagaaagagaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbonic anhydrase II
- phosphomannomutase 1
- WD repeat domain 37
- Coenzyme A synthase

Buy RPL8-ribosomal protein L8 Gene now

Add to cart