Login to display prices
Login to display prices
PMM1-phosphomannomutase 1 Gene View larger

PMM1-phosphomannomutase 1 Gene

PTXBC010855

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PMM1-phosphomannomutase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PMM1-phosphomannomutase 1 Gene

Proteogenix catalog: PTXBC010855
Ncbi symbol: PMM1
Product name: PMM1-phosphomannomutase 1 Gene
Size: 2ug
Accessions: BC010855
Gene id: 5372
Gene description: phosphomannomutase 1
Synonyms: Sec53; phosphomannomutase 1; PMM 1; PMMH-22; brain glucose-1,6-bisphosphatase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagtcaccgcccaggcagcccgcaggaaggagcgcgtcctctgcctgtttgacgtggacgggaccctcacgccggctcgccagaaaattgaccctgaggtggccgccttcctgcagaagctacgaagtagagtgcagatcggtgtggtgggcggctctgactactgtaagatcgctgagcagctgggtgacggggatgaagtcattgagaagtttgattatgtgtttgccgagaacgggacggtgcagtataagcacggacgactgctctccaagcagaccatccagaaccacctgggggaggagctgctgcaggacttgatcaacttctgcctcagctacatggccctgctcaggctgcccaagaagcgtggaaccttcatcgagttccggaatggcatgctgaacatctcgcccatcggccggagctgcaccctggaggagaggatcgagttctccgaactggacaagaaagagaagatccgggagaagttcgtggaagccctgaaaacagagtttgctggcaaagggctgaggttctctcgaggaggcatgatcagctttgacgtcttccccgagggctgggacaagcgctactgcctggatagcctggaccaggacagcttcgacaccatccacttctttgggaacgagactagccctggtgggaacgactttgagatctttgccgacccccggactgttggccacagcgtggtgtctcctcaggacacggtgcagcgatgccgggagattttcttcccagagacagctcatgaggcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: