CBR3-carbonyl reductase 3 Gene View larger

CBR3-carbonyl reductase 3 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CBR3-carbonyl reductase 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CBR3-carbonyl reductase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002812
Product type: DNA & cDNA
Ncbi symbol: CBR3
Origin species: Human
Product name: CBR3-carbonyl reductase 3 Gene
Size: 2ug
Accessions: BC002812
Gene id: 874
Gene description: carbonyl reductase 3
Synonyms: HEL-S-25; SDR21C2; hCBR3; carbonyl reductase [NADPH] 3; NADPH-dependent carbonyl reductase 3; carbonyl reductase (NADPH) 3; epididymis secretory protein Li 25; short chain dehydrogenase/reductase family 21C member 2; carbonyl reductase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtcctgcagccgcgtggcgctggtgaccggggccaacaggggcatcggcttggccatcgcgcgcgaactgtgccgacagttctctggggatgtggtgctcaccgcgcgggacgtggcgcggggccaggcggccgtgcagcagctgcaggcggagggcctgagcccgcgcttccaccaactggacatcgacgacttgcagagcatccgcgccctgcgcgacttcctgcgcaaggagtacggggggctcaatgtactggtcaacaacgcggccgtcgccttcaagagtgatgatccaatgccctttgacattaaagctgagatgacactgaagacaaatttttttgccactagaaacatgtgcaacgagttactgccgataatgaaacctcatgggagagtggtgaatatcagtagtttgcagtgtttaagggcttttgaaaactgcagtgaagatctgcaggaaaggttccacagtgagacactcacagaaggagacctggtggatctcatgaaaaagtttgtggaggacacaaaaaatgaggtgcatgagagggaaggctggcccaactcaccttatggggtgtccaagttgggggtcacagtcttatcgaggatcctggccaggcgtctggatgagaagaggaaagctgacaggattctggtgaatgcgtgctgcccaggaccagtgaagacagacatggatgggaaagacagcatcaggactgtggaggagggggctgagacccctgtctacttggccctcttgcctccagatgccactgagccacaaggccagttggtccatgacaaagttgtgcaaaactggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transformer-2 alpha
- WD repeat domain 25
- ribosomal protein SA
- BTG family, member 3

Buy CBR3-carbonyl reductase 3 Gene now

Add to cart