TRA2A-transformer-2 alpha Gene View larger

TRA2A-transformer-2 alpha Gene

PTXBC017094

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRA2A-transformer-2 alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TRA2A-transformer-2 alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017094
Product type: DNA & cDNA
Ncbi symbol: TRA2A
Origin species: Human
Product name: TRA2A-transformer-2 alpha Gene
Size: 2ug
Accessions: BC017094
Gene id: 29896
Gene description: transformer-2 alpha
Synonyms: AWMS1; HSU53209; transformer-2 protein homolog alpha; TRA-2 alpha; TRA2-alpha; Tra2alpha; htra-2 alpha; transformer-2 alpha; transformer-2 protein homolog A; transformer 2 alpha homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgatgtggaggaaaacaacttcgagggcagagagtctcgctctcagtcaaaatctccaacgggaactcctgctcgtgtaaaatcggagagcaggtcaggatctcgtagtccatcaagggtttccaaacactctgaatcccattctcgatcaagatcaaaatccaggtcgaggtcaaggagacattctcatagacgttacactcgatccagatcccactctcactctcataggagacgatctcgaagtagatcatatacaccagaataccggcggcgaaggagccgaagccattctccaatgtctaaccggagaagacatactggcagcagggcaaatccagatcccaacacttgccttggagtgtttggcctcagtttgtacacaacagagagggatcttcgtgaagtattttctcgatatggaccattgagtggtgtcaatgtggtttatgatcagcgaactgggcgatctcgaggatttgcttttgtgtattttgagagaatagatgactcaaaggaggctatggaaagggcaaatggaatggagctggatggtagaagaattcgggtggattattctataaccaagagagcgcacacaccaacaccaggcatctacatgggcagaccaactcatagtggtgggggtggtggaggaggcggcggcggtggaggtggaggtggtggcagacgtcgagattcttactatgatagaggatatgatcgtgggtatgacagatatgaagactatgattaccgatacagaagacgatcaccttctccttattatagtcgatatagatcacgatcaagatctcgttcctacagcccaagacgctattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 25
- ribosomal protein SA
- BTG family, member 3
- iduronate 2-sulfatase

Buy TRA2A-transformer-2 alpha Gene now

Add to cart