IDS-iduronate 2-sulfatase Gene View larger

IDS-iduronate 2-sulfatase Gene

New product

131,90 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IDS-iduronate 2-sulfatase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IDS-iduronate 2-sulfatase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006170
Product type: DNA & cDNA
Ncbi symbol: IDS
Origin species: Human
Product name: IDS-iduronate 2-sulfatase Gene
Size: 2ug
Accessions: BC006170
Gene id: 3423
Gene description: iduronate 2-sulfatase
Synonyms: MPS2; SIDS; iduronate 2-sulfatase; alpha-L-iduronate sulfate sulfatase; iduronate 2-sulfatase 14 kDa chain; iduronate 2-sulfatase 42 kDa chain; idursulfase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgccaccccggaccggccgaggccttctctggctgggtctggttctgagctccgtctgcgtcgccctcggatccgaaacgcaggccaactcgaccacagatgctctgaacgttcttctcatcatcgtggatgacctgcgcccctccctgggctgttatggggataagctggtgaggtccccaaatattgaccaactggcatcccacagcctcctcttccagaatgcctttgcgcagcaagcagtgtgcgccccgagccgcgtttctttcctcactggcaggagacctgacaccacccgcctgtacgacttcaactcctactggagggtgcacgctggaaacttctccaccatcccccagtacttcaaggagaatggctatgtgaccatgtcggtgggaaaagtctttcaccctgggatatcttctaaccataccgatgattctccgtatagctggtcttttccaccttatcatccttcctctgagaagtatgaaaacactaagacatgtcgagggccagatggagaactccatgccaacctgctttgccctgtggatgtgctggatgttcccgagggcaccttgcctgacaaacagagcactgagcaagccatacagttgttggaaaagatgaaaacgtcagccagtcctttcttcctggccgttgggtatcataagccacacatccccttcagataccccaaggaatttcagaagttgtatcccttggagaacatcaccctggcccccgatcccgaggtccctgatggcctaccccctgtggcctacaacccctggatggacatcaggcaacgggaagacgtccaagccttaaacatcagtgtgccgtatggtccaattcctgtggactttcaggaggaccaaagttccacaggtttcagactgaagacttcatctaccagaaagtataagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - monoglyceride lipase
- carbonic anhydrase X
- apolipoprotein L, 2
- WD repeat domain 67

Buy IDS-iduronate 2-sulfatase Gene now

Add to cart