CA10-carbonic anhydrase X Gene View larger

CA10-carbonic anhydrase X Gene

PTXBC020577

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CA10-carbonic anhydrase X Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CA10-carbonic anhydrase X Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020577
Product type: DNA & cDNA
Ncbi symbol: CA10
Origin species: Human
Product name: CA10-carbonic anhydrase X Gene
Size: 2ug
Accessions: BC020577
Gene id: 56934
Gene description: carbonic anhydrase X
Synonyms: CA-RPX; CARPX; HUCEP-15; carbonic anhydrase-related protein 10; CA-RP X; CARP X; carbonic anhydrase X; carbonic anhydrase-related protein X; cerebral protein-15; carbonic anhydrase 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaatagtctgggaggtgctttttcttcttcaagccaatttcatcgtctgcatatcagctcaacagaattcaccaaaaatccatgaaggctggtgggcatacaaggaggtggtccagggaagctttgttccagttccttctttctggggattggtgaactcagcttggaatctttgctctgtggggaaacggcagtcgccagtcaacatagagaccagtcacatgatcttcgacccctttctgacacctcttcgcatcaacacggggggcaggaaggtcagtgggaccatgtacaacactggaagacacgtatcccttcgcctggacaaggagcacttggtcaacatatctggagggcccatgacatacagccaccggctggaggagatccgactacactttgggagtgaggacagccaagggtcggagcacctcctcaatggacaggccttctctggggaggtgcagctcatccactataaccatgagctatatacgaatgtcacagaagctgcaaagagtccaaatggattggtggtagtttctatatttataaaagtttctgattcatcaaacccatttcttaatcgaatgctcaacagagatactatcacaagaataacatataaaaatgatgcatatttactacaggggcttaatatagaggaactatatccagagacctctagtttcatcacttacgatgggtcgatgactatcccaccctgctatgagacagcaagttggatcataatgaacaaacctgtctatataaccaggatgcagatgcattccttgcgcctgctcagccagaaccagccatctcagatctttctgagcatgagtgacaacttcaggcctgtccagccactcaacaaccgctgcatccgcaccaatatcaacttcagtttacaggggaaggactgtccaaacaaccgagcccagaagcttcagtatagagtaaatgaatggctcctcaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - apolipoprotein L, 2
- WD repeat domain 67
- WD repeat domain 68
- jun B proto-oncogene

Buy CA10-carbonic anhydrase X Gene now

Add to cart