MGLL-monoglyceride lipase Gene View larger

MGLL-monoglyceride lipase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGLL-monoglyceride lipase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGLL-monoglyceride lipase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000551
Product type: DNA & cDNA
Ncbi symbol: MGLL
Origin species: Human
Product name: MGLL-monoglyceride lipase Gene
Size: 2ug
Accessions: BC000551
Gene id: 11343
Gene description: monoglyceride lipase
Synonyms: HU-K5; HUK5; MAGL; MGL; lysophospholipase homolog; monoacylglycerol lipase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaacaggacctgaagacccttccagcatgccagaggaaagttcccccaggcggaccccgcagagcattccctaccaggacctccctcacctggtcaatgcagacggacagtacctcttctgcaggtactggaaacccacaggcacacccaaggccctcatctttgtgtcccatggagccggagagcacagtggccgctatgaagagctggctcggatgctgatggggctggacctgctggtgttcgcccacgaccatgttggccacggacagagcgaaggggagaggatggtagtgtctgacttccacgttttcgtcagggatgtgttgcagcatgtggattccatgcagaaagactaccctgggcttcctgtcttccttctgggccactccatgggaggcgccatcgccatcctcacggccgcagagaggccgggccacttcgccggcatggtactcatttcgcctctggttcttgccaatcctgaatctgcaacaactttcaaggtccttgctgcgaaagtgctcaaccttgtgctgccaaacttgtccctcgggcccatcgactccagcgtgctctctcggaataagacagaggtcgacatttataactcagaccccctgatctgccgggcagggctgaaggtgtgcttcggcatccaactgctgaatgccgtctcacgggtggagcgcgccctccccaagctgactgtgcccttcctgctgctccagggctctgccgatcgcctatgtgacagcaaaggggcctacctgctcatggagttagccaagagccaggacaagactctcaagatttatgaaggtgcctaccatgttctccacaaggagcttcctgaagtcaccaactccgtcttccatgaaataaacatgtgggtctctcaaaggacagccacggcaggaactgcgtccccaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbonic anhydrase X
- apolipoprotein L, 2
- WD repeat domain 67
- WD repeat domain 68

Buy MGLL-monoglyceride lipase Gene now

Add to cart