WDR25-WD repeat domain 25 Gene View larger

WDR25-WD repeat domain 25 Gene

PTXBC003641

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR25-WD repeat domain 25 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR25-WD repeat domain 25 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003641
Product type: DNA & cDNA
Ncbi symbol: WDR25
Origin species: Human
Product name: WDR25-WD repeat domain 25 Gene
Size: 2ug
Accessions: BC003641
Gene id: 79446
Gene description: WD repeat domain 25
Synonyms: C14orf67; WD repeat-containing protein 25; WD repeat domain 25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagctctgtgcctggtgctgtgctggtttcaagggctgttgggagaggtatggaacgccgtggactccgggcactgcctgcagacctactccctgcacacagaggcagtgcgggccgcccggtgggctccctgtggccggcgcatcctcagtggtggctttgacttcgcgctgcacctaacagaccttgaaacaggaacccagctatttagtggtcgaagtgactttagaatcactaccttgaaattccatccaaaagaccacaacatctttttatgtggaggcttcagctctgaaatgaaagcttgggatataaggactggcaaggtgatgagaagctacaaggcgaccatccagcagaccttggacatcctgttcctccgggaaggctccgagttcctgagcagcacagacgcttccacccgggactcagctgaccgcaccattattgcctgggatttccggacctctgccaaaatctccaaccagattttccacgagaggttcacctgccccagcctcgccttgcacccgagagagcccgtgttcctggcacagaccaatggcaactacctggcccttttctccactgtgtggccctaccggatgagcagacggcggcgctatgaagggcacaaggtggagggctactcagtgggctgcgagtgctccccaggcggtgacttgctggtgacgggcagcgccgatggccgggtcctgatgtacagcttccgcacagccagccgagcatgcacactgcaggggcacacacaggcctgtgtcggcaccacctaccaccccgtgctgccctccgtcctcgccacctgctcctggggaggggacatgaagatctggcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein SA
- BTG family, member 3
- iduronate 2-sulfatase
- monoglyceride lipase

Buy WDR25-WD repeat domain 25 Gene now

Add to cart