CA2-carbonic anhydrase II Gene View larger

CA2-carbonic anhydrase II Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CA2-carbonic anhydrase II Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CA2-carbonic anhydrase II Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011949
Product type: DNA & cDNA
Ncbi symbol: CA2
Origin species: Human
Product name: CA2-carbonic anhydrase II Gene
Size: 2ug
Accessions: BC011949
Gene id: 760
Gene description: carbonic anhydrase II
Synonyms: CA-II; CAC; CAII; Car2; HEL-76; HEL-S-282; carbonic anhydrase 2; carbonate dehydratase II; carbonic anhydrase B; carbonic anhydrase C; carbonic anhydrase II; carbonic dehydratase; epididymis luminal protein 76; epididymis secretory protein Li 282
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccatcactgggggtacggcaaacacaacggacctgagcactggcataaggacttccccattgccaagggagagcgccagtcccctgttgacatcgacactcatacagccaagtatgacccttccctgaagcccctgtctgtttcctatgatcaagcaacttccctgaggatcctcaacaatggtcatgctttcaacgtggagtttgatgactctcaggacaaagcagtgctcaagggaggacccctggatggcacttacagattgattcagtttcactttcactggggttcacttgatggacaaggttcagagcatactgtggataaaaagaaatatgctgcagaacttcacttggttcactggaacaccaaatatggggattttgggaaagctgtgcagcaacctgatggactggccgttctaggtatttttttgaaggttggcagcgctaaaccgggccttcagaaagttgttgatgtgctggattccattaaaacaaagggcaagagtgctgacttcacaaactttgcagctcgtggcctccttcctgaatccctggattactggacctacccaggctcactgaccacccctcctcttctggaatgtgtgacctggattgtgctcaaggaacccatcagcgtcagcagcgagcaggtgttgaaattccgtaaacttaacttcaatggggagggtgaacccgaagaactgatggtggacaactggcgcccagctcagccactgaagaacaggcaaatcaaagcttccttcaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphomannomutase 1
- WD repeat domain 37
- Coenzyme A synthase
- interleukin 1, alpha

Buy CA2-carbonic anhydrase II Gene now

Add to cart