Login to display prices
Login to display prices
RPL9-ribosomal protein L9 Gene View larger

RPL9-ribosomal protein L9 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL9-ribosomal protein L9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL9-ribosomal protein L9 Gene

Proteogenix catalog: PTXBC000483
Ncbi symbol: RPL9
Product name: RPL9-ribosomal protein L9 Gene
Size: 2ug
Accessions: BC000483
Gene id: 6133
Gene description: ribosomal protein L9
Synonyms: NPC-A-16; 60S ribosomal protein L9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagactattctcagcaatcagactgtcgacattccagaaaatgtcgacattactctgaagggacgcacagttatcgtgaagggccccagaggaaccctgcggagggacttcaatcacatcaatgtagaactcagccttcttggaaagaaaaaaaagaggctccgggttgacaaatggtggggtaacagaaaggaactggctaccgttcggactatttgtagtcatgtacagaacatgatcaagggtgttacactgggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacgttgttatccaggagaatgggtctcttgttgaaatccgaaatttcttgggtgaaaaatacatccgcagggttcggatgagaccaggtgttgcttgttcagtatctcaagcccagaaagatgaattaatccttgaaggaaatgacattgagcttgtttcaaattcagcggctttgattcagcaagccacaacagttaaaaacaaggatatcaggaaatttttggatggtatctatgtctctgaaaaaggaactgttcagcaggctgatgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice