Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of THRSP-thyroid hormone responsive (SPOT14 homolog, rat) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about THRSP-thyroid hormone responsive (SPOT14 homolog, rat) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031989 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | THRSP |
| Origin species: | Human |
| Product name: | THRSP-thyroid hormone responsive (SPOT14 homolog, rat) Gene |
| Size: | 2ug |
| Accessions: | BC031989 |
| Gene id: | 7069 |
| Gene description: | thyroid hormone responsive (SPOT14 homolog, rat) |
| Synonyms: | LPGP1; Lpgp; S14; SPOT14; THRP; thyroid hormone-inducible hepatic protein; SPOT14 homolog; lipogenic protein 1; spot 14 protein; thyroid hormone responsive (SPOT14 homolog, rat); thyroid hormone responsive SPOT14; thyroid hormone responsive |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggtgctaaccaagcgttaccccaagaactgcctgctgaccgtcatggaccggtatgcagccgaggtgcacaacatggagcaggtggtgatgatccccagccttctgcgggacgtgcagctgagtgggcctgggggccaggcccaggctgaggcccctgatctctacacctacttcaccatgctcaaggccatctgtgtggatgtggaccatgggctgctgccgcgggaggagtggcaggccaaggtggcaggcagcgaagagaatggaaccgcagagacagaggaagtcgaggacgagagtgcctcaggagagctggacctggaagcccagttccacctgcacttctccagcctccatcacatcctcatgcacctcaccgagaaagcccaggaggtgacaaggaaataccaggaaatgacgggacaagtttggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - P antigen family, member 1 (prostate associated) - FXYD domain containing ion transport regulator 5 - linker for activation of T cells family, member 2 - protein kinase, cAMP-dependent, catalytic, beta |