Cart 3 Product Products 356,40 € (empty)
-
1 x C8orf56-ch...113,40 € -
1 x AVL9-AVL9...121,50 € -
1 x LMCD1-LIM...121,50 €
No products
To be determined Shipping
356,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 356,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 356,40 €
View larger 
Data sheet of VAMP4-vesicle-associated membrane protein 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VAMP4-vesicle-associated membrane protein 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007019 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAMP4 |
| Origin species: | Human |
| Product name: | VAMP4-vesicle-associated membrane protein 4 Gene |
| Size: | 2ug |
| Accessions: | BC007019 |
| Gene id: | 8674 |
| Gene description: | vesicle-associated membrane protein 4 |
| Synonyms: | VAMP-4; VAMP24; vesicle-associated membrane protein 4; vesicle associated membrane protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctcccaagtttaagcgccacctcaatgatgatgatgtcacaggttctgtgaaaagtgaaaggagaaatcttttggaagatgattcagatgaagaagaggacttttttctgggaccatctggaccaagatttggacctagaaatgataaaattaagcatgttcagaatcaagtggatgaagttattgatgtcatgcaagaaaatattacaaaggtaattgagagaggggagagactagatgaactacaggacaaatcagaaagcttatcggataatgcaacagcttttagcaacagatccaaacaacttcgaaggcaaatgtggtggcgtggatgcaaaataaaagccatcatggctttggttgctgctatccttttgctagtgattatcattcttatagtcatgaaataccgtacttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vesicle-associated membrane protein 4 - secretory carrier membrane protein 1 - acetyl-Coenzyme A acetyltransferase 1 - N-acetyltransferase 13 (GCN5-related) |